MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

GLPT

The GLPT group of genes confer resistance to Fosfomycin through the mechanism, Fosfomycin target mutation.

References


    Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

    Other Groups in Fosfomycin target mutation

    Sequences

    Download Sequences

    >>MEG_3143|Drugs|Fosfomycin|Fosfomycin_target_mutation|GLPT|RequiresSNPConfirmation
    ATGAATTTTCTTAAACCTGCAAAGCATATTAAGCCTTTGCCAGAAAATCAGATAGATGATACCTATAAACGATTACGTCT
    CCAAGTATTTCTTGGTATTTTCATCGGTTACGCTGGGTACTATTTATTACGTAAAAACTTTTCATTAGCGATGCCGGCAT
    TGCAAGAGCAAGGTTTTACAAAAGCAGAACTAGGTTTTGCGCTTTCTGCTGTTTCCATCGCATATGGATTTAGTAAGTTC
    TTTATGGGTACTGTAAGTGATCGGAGCAATGCACGGATATTCTTAGTTCTTGGATTAGTACTCACTGCTATCGTCAATTT
    GTTAATGGGATTTGTACCGTTCTTTACATCAGGTATCGGTATTATGTTTGTCCTATTATTCTTAAATGGATGGTTTCAAG
    GTATGGGCTGGCCACCTTCAGGCCGTGTTCTCGTTCACTGGTTTAGTGTAAGTGAACGCGGAAGTAAGACTGCTCTTTGG
    AACGTTGCGCATAATGTTGGTGGAGGTATTATGGCACCTATTGCTGCTTGGGGTATTACAACAACAGCATTTATCAACTT
    TGGTTATTTAAAAGGTTTTGAAGGTGTATTCATTTACCCTGCACTCTTAGCACTTATCATTGCCGCAATTTCATATATAT
    TGATTAGAGACACACCTCAATCTCAAGGTTTACCTCCAATCGAAATTTATAAAAATGACTTTGCTACAAGCGATAAGAAA
    ACATTAGAAACAGAATTAACTACAAAAGAAATTTTATTTAAATATGTACTGAACAATAAATGGGTATGGGCAATTGCCTT
    TGCAAATATATTTGTTTATTTCGTGCGTTATGGTGTACTTGATTGGGCGCCAGTCTACTTAAGTGAAGAAAAACATTTCG
    ACTTAAAAGCATCAGGTTGGGCATACTTCTTATACGAATGGGCTGGAATTCCTGGTACATTATTATGTGGTTACATTTCT
    GATAAATTATTCAAAGGTCGCCGTGGACCTGCTGGTTTCTTCTTTATGTTAGGTGTCACAGTATTTGTATTAATTTATTG
    GTTAAATCCTCCAGGCAATGCTTGGTTAGACAATGTCTCATTAATTGCCATTGGTTTCTTAATATATGGACCAGTTATGT
    TAATTGGTTTACAAGCATTAGATTATGTACCTAAAAAAGCAGCTGGCACAGCAGCTGGATTAACTGGATTATTTGGTTAT
    CTGTTTGGTGCTGTAATGGCCAACATCGTCTTAGGTGCTGTAGTTGATAAATTCGGATGGGATGTCGGTTTTATTTTATT
    AACAGCAATCAGTGTGTTTGCAATGTTGAGCTTTATCCTCACTTGGAATAAAGTAGGACAAGAAACTGTTCATCATTAA

    >>MEG_3144|Drugs|Fosfomycin|Fosfomycin_target_mutation|GLPT|RequiresSNPConfirmation
    ATGTTGAGTATTTTTAAACCAGCGCCACACAAAGCGCGCTTACCTGCCGCGGAGATCGATCCGACTTATCGTCGATTGCG
    CTGGCAAATTTTCCTGGGGATATTCTTTGGCTATGCGGCTTACTATTTGGTTCGTAAGAACTTTGCGCTTGCTATGCCTT
    ATCTGGTTGAGCAGGGATTCTCACGCGGTGATTTAGGTTTTGCCCTTTCGGGGATCTCGATTGCTTATGGATTTTCGAAA
    TTCATCATGGGTTCGGTATCGGATCGCTCGAATCCGCGCGTTTTCCTGCCCGCAGGTTTGATTCTGGCGGCGGCAGTGAT
    GTTGTTTATGGGCTTTGTGCCATGGGCGACGTCGAGCATTGCGGTGATGTTTGTACTGTTGTTCCTCTGCGGTTGGTTCC
    AGGGGATGGGGTGGCCGCCGTGTGGTCGTACTATGGTGCACTGGTGGTCGCAGAAAGAACGTGGCGGCATTGTGTCAGTG
    TGGAACTGTGCGCACAACGTCGGTGGTGGTATTCCGCCGCTGCTGTTCCTGCTGGGGATGGCCTGGTTCAATGACTGGCA
    TGCGGCGCTCTATATGCCTGCTTTCTGCGCCATTCTGGTGGCATTATTCGCCTTTGCGATGATGCGCGATACCCCGCAAT
    CCTGTGGCTTGCCGCCGATCGAAGAGTACAAAAATGATTATCCGGACGACTATAACGAAAAAGCGGAACAGGAGCTGACG
    GCGAAGCAAATCTTCATGCAGTACGTACTGCCGAACAAACTGCTGTGGTATATCGCCATCGCCAACGTGTTCGTTTATCT
    GCTGCGTTACGGCATCCTCGACTGGTCACCGACTTATCTGAAAGAGGTTAAGCATTTCGCGCTAGATAAATCCTCCTGGG
    CCTACTTCCTTTATGAATATGCAGGTATTCCGGGCACTCTGCTGTGCGGCTGGATGTCGGATAAAGTCTTCCGTGGCAAC
    CGTGGGGCAACCGGCGTTTTCTTTATGACACTGGTGACCATCGCGACTATCGTTTACTGGATGAACCCGGCAGGTAACCC
    AACCGTCGATATGATTTGTATGATTGTTATCGGCTTCCTGATCTACGGTCCTGTGATGCTGATCGGTCTGCATGCGCTGG
    AACTGGCACCGAAAAAAGCGGCAGGTACGGCAGCGGGCTTTACCGGGCTGTTTGGTTACCTGGGCGGTTCGGTGGCGGCG
    AGCGCGATTGTTGGCTACACCGTGGACTTCTTCGGCTGGGATGGCGGCTTTATGGTAATGATTGGCGGCAGCATTCTGGC
    GGTTATCTTGTTGATTGTTGTGATGATTGGCGAAAAACGTCGCCATGAACAATTACTGCAAGAACGCAACGGAGGCTAA