MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

GADX

The gadX gene encodes an araC family transcriptional regulator that affects the expression of the MdtEF multi-drug efflux system in Escherichia coli.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/18297445

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Drug and biocide RND efflux regulator

Sequences

Download Sequences

>>MEG_3083|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|GADX
ATGCAATCACTACATGGGAATTGTCTAATTGCGTATGCAAGACATAAATATATTCTCACCATGGTTAATGGTGAATATCG
CTATTTTAATGGCGGTGACCTGGTTTTTGCGGATGCAAGCCAAATTCGAGTAGATAAGTGTGTTGAAAATTTTGTATTCG
TGTCAAGGGACACGCTTTCATTATTTCTCCCGATGCTCAAGGAGGAGGCATTAAATCTTCATGCACATAAAAAAGTTTCT
TCATTACTCGTTCATCACTGTAGTAGAGATATTCCTGTTTTTCAGGAAGTTGCGCAACTATCGCAGAATAAGAATCTTCG
CTATGCAGAAATGCTACGTAAAAGAGCATTAATCTTTGCGTTGTTATCTGTTTTTCTTGAGGATGAGCACTTTATACCGC
TGCTTCTGAACGTTTTACAACCGAACATGCGAACACGAGTTTGTACGGTTATCAATAATAATATCGCCCATGAGTGGACA
CTAGCCCGAATCGCCAGCGAGCTGTTGATGAGTCCAAGTCTGTTAAAGAAAAAATTGCGCGAAGAAGAGACATCATATTC
ACAGTTGCTTACTGAGTGTAGAATGCAACGTGCTTTGCAACTTATTGTTATACATGGTTTTTCAATTAAGCGAGTTGCAG
TATCCTGTGGATATCACAGCGTGTCGTATTTCATTTACGTCTTTCGAAATTATTATGGGATGACGCCCACAGAGTATCAG
GAGCGATCGGCGCAGAGATTGTCGAACCGTGACTCGGCGGCAAGTATTGTTGCGCAAGGGAATTTTTACGGCACTGACCG
TTCTGCGGAAGGAATAAGATTATAG