MEGAResFrom MEG, the Microbial Ecology Group

BLAB

The blaB gene encodes an Ambler class B beta-lactamase.

References

Other Groups in Class B betalactamases

Sequences

Download Sequences

>Bla|B-5|AF189303|1-750|750|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAGATTAAAAGGATTATTGGTTCTGGCTTTAGGTTTTACAGGACTACAGGTTTTTGGACAGCAAAATCCTGA
TATTAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTTAAAGGAACTAAATATGCGGCTA
ATGCGGTATATATGGTAACGGATAAAGGAGTAGTGGTGATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACA
GACGAGATTTATAAAAAGCACGGAAAGAAAGTCATCATGAACATTGCTACCCATTCTCATGACGATAGAGCCGGAGGTCT
TGAATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAACACTGAGTTCCAGGTCTATTATCCGGGAAAAGGG
CATACGGCAGATAATGTGGTGGTATGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGTGGTGATTC
GAAAGACCTTGGATATATTGGAGAAGCTTATGTAAACGACTGGACACAGTCTATACACAATATTCAGCAGAAATTTCCCG
ATGTTCAGTATGTCGTTGCAGGCCACGATGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAT
TACCAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-6|AF189302|1-747|747|betalactams|Class_B_betalactamases|BLAB
ATGAAAAGATTAAAAGGATTATTGGTTCTGGCTTTAGGTTTTACAGGACTACAGGTTTTTGGACAGCAAAATCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTTAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACGGATAAAGGAGTAGTGGTGATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGAAAGAAAGTCATCATGAACATTGCTACCCATTCTCATGACGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAACACTGAGTTCCAGGTCTATTATCCGGGAAAAGGTCAT
ACAGCAGATAATGTGGTTGTGTGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGCGGTGATTCGAA
AGACCTTGGGTTTATTGGAGAAGCTTATGTAAACGACTGGACACAGTCCATACACAACATTCAGCAGAAATTTCCCGATG
TTCAGTATGTCGTTGCAGGTCACGATGACTGGAAGGATCAAACATCAATACAGCATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-9|AY348324|1-747|747|betalactams|Class_B_betalactamases|BLAB
ATGAAAGGATTAAAAGGGCTATTGGTTCTGGCTTTAGGCTTTACAGGACTACAGGTTTTTGGGCAACAGAACCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTCAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACCGATAAAGGAGTAGTGGTGATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGAAAGAAAGTCATCATGAACATTGCTACACATTCTCATGACGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAACACTGAGTTCCAGGTCTATTATCCGGGAAAAGGTCAT
ACAGCAGATAATGTGGTGGTATGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGCGGTGATTCGAA
AGACCTTGGGTTTATTGGGGAAGCTTATGTAAACGACTGGACACAGTCCATACACAACATTCAGCAGAAATTTCCCGATG
TTCAGTATGTCGTTGCAGGTCATGACGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTA

>Bla|B-3_2_AF189299|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTTTGCAGGCATTTGGACAGGAGAATCCTGA
TGTCAAAATTGAAAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCAA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATTAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGG
CACACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGTGCTGATTC
AAAGGACCTGGGATATATTGGAGAAGCATATGTAAATGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCCG
GTGCTCAGTACGTTGTTGCAGGTCATGATGACTGGAAGGATCAAACATCAATACAGCATACATTGGATTTAATCAGTGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-13|EF595959|1-750|750|betalactams|Class_B_betalactamases|BLAB
ATGATGAAGAAAATGAAATGGGCACTTGTTCTTGCTCTTGGACTTACAGGTTTAAATGCCTTCGGGCAGGAAACTCCTGA
AGTAAAAATAGAAAAGCTAAAAGACAATTTATATGTTTATACAACATATAATACATTCAACGGAACCAAATACGCAGCTA
ATGCGGTATATCTGGTGACCAGTAAAGGGGTGGTTGTAATAGATTCTCCATGGGGTGAGGAAAAATTTAAAAACTTTACC
GACGAAATTTATAAAAGACACGGAAAGAAAGTCATCATGAATATTGCAACACATTCTCATGACGACCGTGCAGGAGGTTT
GGAATATTTTAAAAGCTTAGGGGTAAAAACCTATTCTACTAAAATGACAGACTCTATTTTAGCGAAAGATAATAAGCCAA
GAGCCCAGTATACTTTTGATAATAATAAATCATTTAAAGTAGGAAAGGATGAGTTTCAGGTCTATTATCCGGGAAAAGGA
CATACAGCTGACAATGTAGTGGTATGGTTCCCTAAAGATAAAGTACTGGTGGGAGGCTGTATTATAAAAAGCGGTGATTC
CAAAAATCTTGGATTTTTGGGAGAAGCATATGTAAACGACTGGACACAGTCAGTACACAATATTCAGAAGAAATTTCCCA
ATGTACAATATGTTGTTGCAGGCCACGATGACTGGAAAGATCAGACTGCCATTCAGCATACACTGGATTTAATCAGTGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-9_1_AY348324|betalactams|Class_B_betalactamases|BLAB
ATGAAAGGATTAAAAGGGCTATTGGTTCTGGCTTTAGGCTTTACAGGACTACAGGTTTTTGGGCAACAGAACCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTCAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACCGATAAAGGAGTAGTGGTGATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGAAAGAAAGTCATCATGAACATTGCTACACATTCTCATGACGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAACACTGAGTTCCAGGTCTATTATCCGGGAAAAGGTCAT
ACAGCAGATAATGTGGTGGTATGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGCGGTGATTCGAA
AGACCTTGGGTTTATTGGGGAAGCTTATGTAAACGACTGGACACAGTCCATACACAACATTCAGCAGAAATTTCCCGATG
TTCAGTATGTCGTTGCAGGTCATGACGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-3|AF162284|1-750|750|betalactams|Class_B_betalactamases|BLAB
ATGATGAAGAAAATGAAATGGGCACTTGTTCTTGCTCTTGGACTTACAGGTTTAAATGCCTTCGGGCAGGAAACTCCTGA
AGTAAAAATAGAAAAGCTAAAAGACAATTTATATGTTTATACAACATATAATACATTCAACGGAACCAAATACGCAGCTA
ATGCGGTATATCTGGTGACCAGTAAAGGGGTGGTTGTAATAGATTCTCCATGGGGTGAGGAAAAATTTAAAAACTTTACC
GACGAAATTTATAAAAGACACGGAAAGAAAGTGATCATGAATATTGCAACACACTCTCATGATGACCGTGCAGGAGGTTT
GGAATATTTTAAAAGCTTAGGGGCAAAAACCTATTCTACTAAAATGACAGACTCTATTTTAGCGAAAGATAATAAGCCAA
GAGCCCAGTATACTTTTGATAATAATAAATCATTTAAAGTAGGAAAGGATGAGTTTCAGGTCTATTATCCGGGAAAAGGA
CATACAGCTGACCATGTAGTGGTATGGTTCCCTAAAGATAAAGTACTGGTGGGCGGCTGTATTATAAAAAGTGGGGATTC
CAAAGATCTTGGCTTTTTGGGAGAAGCATATGTAAACGACTGGACACAGTCAGTACACAATATTCAGAAGAAATTTCCCA
ATGTACAATATGTTGTTGCAGGCCACGATGACTGGAAAGATCAGACTGCCATTCAGCATACACTGGATTTAATCAGTGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-7|AF189304|1-747|747|betalactams|Class_B_betalactamases|BLAB
ATGAAAGGATTAAAAGGGCTATTGGTTCTGGCTTTAGGTTTTACAGGACTACAGGTTTTTGGGCAACAGAACCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTCAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACCGATAAAGGAATAGTGGTTATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGTAAGAAAGTTATCATGAACATTGCGACCCACTCTCATGATGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAAGACTGAGTTTCAGGTCTATTATCCGGGAAAAGGTCAT
ACAGCAGATAATGTGGTTGTGTGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGTGGTGATTCGAA
AGACCTTGGGTTTATTGGAGAAGCTTATGTAAACGACTGGACACAGTCCATACACAATATTCAGCAGAAATTTCCCGATG
TTCAGTATGTCGTTGCAGGTCATGACGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-8|AF189305|1-747|747|betalactams|Class_B_betalactamases|BLAB
ATGAAAGGATTAAAAGGACTATTGGTTCTGGCTTTAGGTTTTACAGGACTACAGGTTTTTGGGCAACAGAACCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACATATAATACCTTCAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACCGATAAAGGAGTAGTGGTTATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGAAAGAAAGTTATCATGAACATTGCGACCCACTCTCATGATGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAAGACTGAGTTTCAGGTCTATTATCCAGGAAAAGGTCAT
ACAGCAGATAATGTGGTTGTATGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGCGGTGATTCGAA
AGATCTTGGGTTTATTGGAGAAGCTTATGTAAACGACTGGACACAGTCCATACACAACATTCAGCAGAAATTTCCCGATG
TTCAGTATGTCGTTGCAGGTCATGACGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-10|AY348325|1-747|747|betalactams|Class_B_betalactamases|BLAB
ATGAAAGGATTAAAAGGGCTATTGGTTCTGGCTTTAGGCTTTACAGGACTACAGGTTTTTGGGCAACAGAACCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTCAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACCGATAAAGGAGTAGTGGTTATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGAAAGAAAGTTATCATGAACATTGCAACCCACTCTCATGATGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAAGACTGAGTTTCAGGTTTATTATCCGGGAAAAGGTCAT
ACAGCAGATAATGTGGTTGTGTGGTTTCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGTGGTGATTCGAA
AGACCTTGGGTTTATTGGGGAAGCTTATGTAAACGACTGGACACAGTCCATACACAACATTCAGCAGAAATTTCCCTATG
TTCAGTATGTCGTTGCAGGTCATGACGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-11|AY348326|1-750|750|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTCTGCAGGCATTTGGACAGGAGAATCCTGA
TGTCAAAATTGAAAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCTA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATGAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGA
CACACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGCGCTGATTC
AAAAGACCTGGGGTATATTGGAGAAGCATATGTAAACGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCCG
GTGCTCAGTACGTTGTTGCAGGGCATGATGATTGGAAAGATCAAAGATCAATACAACGTACACTAGACTTAATCAATGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-14|JN635697|973-1719|747|betalactams|Class_B_betalactamases|BLAB
ATGAAGAATATAATGCGGGCACTGATCCTTGTTTTTGGTTTTATGAGTTTTTTTATGTTTGGACAGGAGAATCCTGACGT
CAAAATTGAAAAGCTAAGAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCTAATG
CAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACGGAC
GAGATTTATAAAAAACACGGAAAGAAAGTTATTATGAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCTTGA
ATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGACAT
ACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGCGCTGATTCAAA
AGACCTGGGGTATATTGGAGAAGCATATGTAAATGACTGGACGCAGTCTGTACACAATATTCAACAGAAGTTTTCCGGTG
CTCAGTACGTTGTTGCGGGGCATGATGATTGGAAAGATCAAAGATCAATACAACGTACACTAGACTTAATCAATGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-12|EF595958|1-750|750|betalactams|Class_B_betalactamases|BLAB
ATGATGAAGAAAATGAAATGGGCACTTGTTCTTGCTCTTGGACTTACAGGTTTAAATGCCTTCGGGCAGGAAACTCCTGA
AGTAAAAATAGAAAAGCTAAAAGACAATTTATATGTTTATACAACATATAATACATTCAACGGAACCAAATACGCAGCTA
ATGCGGTATATCTGGTGACCAGTAAAGGGGTGGTTGTAATAGATTCTCCATGGGGTGAGGAAAAATTTAAAAACTTTACC
GACGAAATTTATAAAAGACACGGAAAGAAAGTCATCATGAATATTGCAACCCATTCTCATGACGACCGTGCAGGAGGTTT
GGAATATTTTAAAAGCTTAGGGGTAAAAACCTATTCTACTAAAATGACAGACTCTATTTTAGCGAAAGATAATAAGCCAA
GAGCCCAGTATACTTTTGATAATAATAAATCATTTAAAGTAGGAAAGGATGAGTTTCAGGTCTATTATCCGGGAAAAGGA
CATACAGCTGACAATGTAGTGGTATGGTTCCCTAAAGATAAAGTACTGGTGGGAGGCTGTATTATAAAAAGCGGTGATTC
CAAAGATCTTGGATTTTTGGGAGAAGCATATGTAAACGACTGGACACAGTCAGTACACAATATTCAGAAGAAATTTCCCA
ATGTACAATATGTTGTTGCAGGCCACGATGACTGGAAAGATCAGACCGCCATTCAGCATACACTGGATTTAATCAGTGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>Bla|blaB-3_1_AF189301|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTTTGCAGGCATTTGGACAGGAGAATCCTGA
TGTCAAAATTGAAAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCAA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATTAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGG
CACACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGTGCTGATTC
AAAGGACCTGGGATATATTGGAGAAGCATATGTAAATGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCTG
GTGCTCAGTACGTTGTTGCAGGTCATGATGACTGGAAGGATCAAACATCAATACAGCATACATTGGATTTAATCAGTGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>Bla|X96858.1|gene1|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTTTGCAGGCATTTGGACAGGAGAATCCTGA
TGTCAAAATTGAAAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCAA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATGAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGG
CACACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGTGCTGATTC
AAAGGACCTGGGGTATATTGGAGAAGCATATGTAAACGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCCG
GTGCTCAGTACGTTGTTGCAGGGCATGATGATTGGAAAGATCAAAGATCAATACAACATACACTAGACTTAATCAATGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-2|AF189300|1-750|750|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTCTGCAGGCATTTGGACAGGAGAATCCTGA
CGTTAAAATTGATAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCTA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATGAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGA
CATACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGCGCTGATTC
AAAAGACCTGGGGTATATTGGAGAAGCATATGTAAACGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCCG
GTGCTCAGTACGTTGTTGCAGGGCATGATGATTGGAAAGATCAAAGATCAATACAACGTACACTAGACTTAATCAATGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>Bla|B-1|AF189298|1-750|750|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTTTGCAGGCATTTGGACAGGAGAATCCTGA
TGTCAAAATTGAAAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCAA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATGAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGG
CACACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGTGCTGATTC
AAAGGACCTGGGGTATATTGGAGAAGCATATGTAAACGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCCG
GTGCTCAGTACGTTGTTGCAGGGCATGATGATTGGAAAGATCAAAGATCAATACAACATACACTAGACTTAATCAATGAA
TATCAGCAAAAACAAAAGGCTTCAAATTAA