MEGAResFrom MEG, the Microbial Ecology Group

CEPA

The cepA gene encodes an Ambler class A beta-lactamase.

References

Other Groups in Class A betalactamases

Sequences

Download Sequences

>Bla|CEPA-44|U05885|556-1458|903|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAATCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGAAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCACAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATGAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTGGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGGCAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGCCTATAGCATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGGGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAAAGCAACAGATAGATTAA

>Bla|CEPA-29|U05884|556-1458|903|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGAAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAATATACCCACAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATGAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTAGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACAGACATGCCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA

>Bla|CEPA-85|U05887|556-1458|903|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGAAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCACAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATGAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTAGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGTCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA

>Bla|CEPA-49|U05886|404-1306|903|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTAAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGGAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCACAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATAAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTAGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGTCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCACATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA

>Bla|cepA_6_FR688022|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCTATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGGAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCGCAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATGAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTGGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGCCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA

>Bla|cepA_1_L13472|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGGAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCACAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATAAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTAGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGCCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA

>CARD|phgb|U05883|555-1458|ARO:3003559|cepA|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGGAAACCCGATTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCGCAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATAAAAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTAGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGCCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA