Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

CEPA

The cepA gene encodes an Ambler class A beta-lactamase.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8285623

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class A betalactamases

Sequences

Download Sequences

>>MEG_1645|Drugs|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGAAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAATATACCCACAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATGAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTAGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACAGACATGCCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA

>>MEG_1646|Drugs|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAATCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGAAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCACAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATGAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTGGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGGCAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGCCTATAGCATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGGGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAAAGCAACAGATAGATTAA

>>MEG_1647|Drugs|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTAAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGGAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCACAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATAAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTAGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGTCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCACATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA

>>MEG_1648|Drugs|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGAAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCACAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATGAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTAGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGTCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA

>>MEG_1649|Drugs|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGGAAACCCGATTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCGCAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATAAAAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTAGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGCCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA

>>MEG_1650|Drugs|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCTATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGGAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCGCAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATGAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTGGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGCCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA

>>MEG_1651|Drugs|betalactams|Class_A_betalactamases|CEPA
ATGCAAAAAAGACTTATACATTTATCCATTATCTTCTTTCTGCTATGTCCTGCCCTGGTAGTTGCGCAGAACAGTCCTCT
TGAAACTCAACTCAAGAAAGCCATAGAAGGGAAAAAAGCCGAAATAGGAATTGCAGTCATTATCGACGGGCAAGATACGA
TAACAGTCAATAATGATATTCATTATCCCATGATGAGTGTTTTCAAATTTCATCAGGCATTGGCATTGGCCGATTACATG
CATCATCAAAAGCAACCTTTGGAAACCCGGTTATTGATTAAAAAGTCGGATTTAAAGCCGGACACCTATAGTCCGCTTCG
AGAAACATACCCACAGGGAGGAATCGAAATGAGCATTGCCGATCTACTGAAATATACGCTTCAGCAAAGTGACAATAATG
CCTGCGATATTCTTTTTAATTATCAAGGTGGTCCGGATGCCGTGAATAAGTATCTTCATTCATTGGGAATTCGTGAATGT
GCTGTCATCCATACAGAAAACGATATGCATAAGAATCTGGAGTTCTGTTACCAAAACTGGACTACTCCATTAGCAGCCGC
CAAATTACTGGAAATATTTCGCAATGAAAACCTTTTTGACAAAGAATACAAGAATTTCATTTATCAAACAATGGTGGAAT
GTCAGACAGGACAAGACCGCCTGATTGCTCCACTGCTCGATAAAAAAGTAACAATGGGGCATAAAACCGGAACAGGCGAC
CGTAATGCGAAAGGACAACAGATCGGTTGCAATGACATCGGGTTTATTCTTCTTCCCGACGGACATGCCTATAGTATAGC
CGTCTTCGTGAAAGATTCCGAAGCAGATAACAGAGAAAACAGTGAGATTATCGCAGAAATTTCGCGCATCGTTTACGAAT
ACGTAACGCAACAGATAGATTAA