Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

CARB

The CARB genes encode Ambler class A beta-lactamases.

References

  • http://aac.asm.org/content/51/6/2185.full

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Other Groups in Class A betalactamases

Sequences

Download Sequences

>>MEG_1492|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacgcgtatcgaacacgcttgtgaggccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgatctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacaccgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagatcactacaaagaaagttaa

>>MEG_1493|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaattgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgcatcgaacacgcttgtgaagccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacactgtttttgcgctctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcgaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacataccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctgccaaaagactggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacaccgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1494|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggagagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgtatcgaacacgcttgtgaggccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgatctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcaaaaccgggcgataagcgagacaccacaacgcctaacgccatggtaaacaccctacataccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1495|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacatttaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtctggtctccggtgatggataaactggctggaca
aagcacacgcatcgaacacgcttgtgaagccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgttgtttttgcgctctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcgaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacataccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaaccacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
gctgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1496|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgcagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgcatcgaacacgcttgtgaagccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgatctattggcgacaaagcaacgcgacttgaccgattggaacccggt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
gctgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1497|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttatttttgttggctgggctaatggtttgctcaaccctaagttacgcgtcccaactgaatgaggacatttc
tctcctcgagcaacaaacctcaagcagaattggggtgtcagtttgggatacccaagcagacgagcgttgggattaccgtg
gcgatgaacgcttcccactcatgagcacattcaaaaccctagcttgtgccaaaatgttaagtgatatggacagcggtaag
ctaagtaaaaatgcgaccgcaaaagtcgatgagcgcagtatcgttgtatggtctccagtgatggataagctcgcaggcca
aaacacacgcatagagcacgcgtgtgaagccgctatgttaatgagtgataataccgcagccaacttagtattaaatgaaa
ttggcggccctaaggccgtaacaatgtttctgcgaacaattggagataaagcaacgcgcctagacagaatagaacctcgc
ttgaacgaagccacaccaggcgacagccgcgacacaactacacctaacgccatactaaacactcttcgaactttggtcga
aggcgaaacgttgtcttatgagtctcgtgtacaattaaaaatctggatgcaggacaacaaagtttcagactcgttaatgc
gttctgtattaccaacaggttggtctattgcagaccgttctggtgcgggaggtcatggttcgcgtggcattaacgcgatt
atatggaaggaaaatcatcgacctgtttacattagtatttatgtcacagaaaccgagctctcacttcaagctagggacca
actcgttgcgcagataagtcagttgattttacaaaagtacaaagacaattaa

>>MEG_1498|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttactcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacatttaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggcaggaca
aagcacacgtatcgaacacgcttgtgaagccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacactgtttttgcgctctattggcgacaaagcaacgcgacttgaccgattggagccccgt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacataccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattcgctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacaccgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1499|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatatc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgtatcgaacacgcttgtgaggccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgttgtttttgcgatctattggcgacaacgcaacgcgacttgaccgattggagccccgt
ttaaacgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgctatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
gctgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1500|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctggacgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgatatggacagcggcaaa
ctcaacaaaaatgccacagcgagaatcaatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgtatcgaacacgcttgtgaagccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacactgtttttgcgctctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattcgctcatgc
gctctgttctaccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atttggaaagacaactacaagccggtttacattagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1501|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaaagcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgcatcgaacacgcttgtgaagccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgatctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcaaaaccgggcgacaagcgagacactacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattcgctcatgc
gttctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacaccgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1502|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactgactggaca
aagcacacgtatcgaacacgcttgtgaggccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacactgtttttgcgctctattggcgacaaagcaacgcgacttgaccgattggagccccgt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacaactgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctaccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atttggaaagacaactacaagccggtttacatcagtatttacgtcacagacaccgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1503|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aaacacacgcatcgaacacgcttgtgaagctgccatgttgatgagcgacaacaccgccgcgaacttagtgttaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgctctattggcgacaaaacaacgcgacttgaccgattggagcctcgt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattcgctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1504|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgcatcgaacacgcttgtgaagccgccatgttgatgagcgacaacaccgccgcgaacttagtgttaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgctctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcactcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacacagacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1505|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgcatcgaacacgcttgtgaggccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaataaaa
ttggtggtcctaaagcggtcacgctgtttttgcgatctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1506|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgcatcgaacacgcttgtgaggccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtgacgttatttttgcgatctattggcgacaaagcaacgcgacttgaccgattggaacccggt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattcgctcatgc
gctctgttctaccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccagtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
gctgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1507|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgtatcgaacacgcttgtgaggccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacactgtttttgcgctctattggcgacgaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacaccgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1508|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgtatcgaacacgcttgtgaggccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgatctattggtgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaacgaagcaaaaccgggcgacaagcgagataccacaacgcctaacgccatggtaaacaccctacactccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattcgctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1509|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgtgtcgaacacgcttgtgaggctgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgatctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcaaaaccgggcgataagcgagacaccacaacgcctaacgccatggtaaacaccctacataccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacaccgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1510|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgagaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgtatcgaacacgcttgtgaagccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacactgtttttgcgctctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcaaaaccgggcgacaagcgagataccacaacgcctaacgccatggtaaacaccctacataccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattcgctcatgc
gctctgttctaccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacaccgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1511|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggatagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgcatcgaacacgcttgtgaagccgccatgttgaggagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgttgtttttgcgatctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacataccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattcgctcatgc
gctctgttctgccaaaaggttggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atttggaaagacaactacaagccggtttacatcagtatttacgtcacagacaccgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1512|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggatagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgtatcgaacacgcttgtgaagccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacactgtttttgcgctctattggcgacaaagcaacgcgacttgaccgattggagccccgt
ttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacaccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1513|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaatggacgaacgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgagaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacgcgtatcgaacacgcttgtgaagccgccatgttgatgagcgacaacaccgccgcaaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgctctgttggcgacaaagcaacgcgacttgaccgattggagccccgt
ttgaacgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctaccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atttggaaagacaactacaagccggtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcgctacaaagaaagttaa

>>MEG_1514|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaatggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgtatagaacacgcttgtgaagccgccatgttgatgagtgacaactccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgatctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaacgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagttgaaaatctggatgcaagacaacaaagtatcggattcgctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atttggaaagacaactacaagccggtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1515|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcctccaaattaaatttaaatgaaga
catctccctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggatt
atcgcggagacgaacgtttcccattaatgagcacatttaaaacgttagcgtgtgccaccatgctaagcgacatggacagc
ggcaaactcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggc
tggacaaagtacacgtatcgaacacgcttgtgaggccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaa
atgaaattggtggtcctaaagcggtcacactgtttttgcgctctattggcgacaaagcaacgcgacttgaccgattggag
ccccgtttgaatgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacacctt
gatggaagataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctc
tcatgcgctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagc
gcgatgatttggaaagacaactacaagccggtttacatcagtatttacgtcacagacactgacctttcgcttcaagctcg
cgatcaactgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1516|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcgtccaaattaaacgaagacatatc
catcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaacggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgaaaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacacgtatcgaacacgcttgtgaggccgccatgttgatgagcgacaacaccgccgcgaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgatctattggcgacaaagcaacgcgacttgaccgattggaaccccgt
ttgaatgaagcaaaaccgggcgataagcgagacaccacaacgcctaacgccatggtaaacaccctacataccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattcgctcatgc
gctctgttctgccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atctggaaagacaactacaagccggtttacatcagtatttacgtcacagacaccgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1517|Drugs|betalactams|Class_A_betalactamases|CARB
atgaaaaagttattcctgttggttgggctgatggtttgctcaactgttagttacgcttccaaattaaacgaagacatctc
cctcatcgagaaacaaacatctgggcgaattggagtgtcagtctgggatacacaaatggacgagcgttgggattatcgcg
gagacgaacgtttcccattaatgagcacattcaaaacgttagcgtgtgccaccatgctaagcgacatggacagcggcaaa
ctcaacaaaaatgccacagcgagaatcgatgaacgcaatattgtggtttggtctccggtgatggataaactggctggaca
aagcacgcgtatcgaacacgcttgtgaagccgccatgttgatgagcgacaacaccgccgcaaacttagtgctaaatgaaa
ttggtggtcctaaagcggtcacgctgtttttgcgctctattggcgacaaagcaacgcgacttgaccgattggagccccgt
ttgaacgaagcaaaaccgggcgacaagcgagacaccacaacgcctaacgccatggtaaacaccctacacaccttgatgga
agataacgccctatcttacgagtcacgcacacagctgaaaatctggatgcaagacaacaaagtatcggattctctcatgc
gctctgttctaccaaaaggctggtcgattgcagaccgctctggcgcaggtaactacggttcacgcggcattagcgcgatg
atttggaaagacaactacaagccggtttacatcagtatttacgtcacagatactgacctttcgcttcaagctcgcgatca
actgatcgcgcaaatcagccaactgattttagagcactacaaagaaagttaa

>>MEG_1518|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAGTTTTTATTGGCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACA
AGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGG
ATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAG
CAAGGAAAAGTTAATTCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCA
AGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCC
TAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATT
GAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATAA
ATTTTTATTTGGTTCCGCGCTATCTGAAATGAACCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTA
ATTTACTACGTTCAGTATTGCCGGCGGGATGGAACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATT
ACAGCAGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGA
GCGAAATGATGCGATTGTTAAAATTGGTCATTCAATTTTTGACGTTTATACATCACAGTCGCGCTGA

>>MEG_1519|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAGTTTTTATTGGCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACA
AGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGG
ATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAG
CAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCA
AGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCC
TAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATT
GAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATAA
ATTTTTATTTGGTTCCGCGCTATCTGAAATGAACCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTA
ATTTACTACGTTCAGTATTGCCGGCGGGATGGAACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATT
ACAGCAGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGA
GCGAAATGATGCGATTGTTAAAATTGGTCATTCAATTTTTGACGTTTATACATCACAGTCGCGCTGA

>>MEG_1520|Drugs|betalactams|Class_A_betalactamases|CARB
AGCAGGGCAGTCGCCCTAAAACAAAGTTAGCCATATTATGGAGCCTCATGCTTTTATATAAAATGTGTGACAATCAAAAT
TATGGGGTTACTTACATGAAGTTTTTATTGGCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTT
TCAGCAAGTTGAACAAGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAA
ATGGAGAATATTGGGATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTA
CTATATGATGCTGAGCAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCC
TGTAATAGAAAAGCAAGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTG
CGGCAAATATCATCCTAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACT
CGTCTAGACCGTATTGAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGC
CAGCACGTTAAATCAATTATTATTTGGTTCCACATTATCTGAAGCTAGTCAGAAAAAATTAGAGTCTTGGATGGTGAACA
ATCAAGTTACGGGTAATTTATTGAGGTCAGTATTGCCAGTGAAGTGGAGTATTGCTGATCGCTCAGGAGCAGGTGGATTT
GGTGCTAGGAGTATTACAGCGATTGTGTGGAGTGAAGAAAAAAAAACGATTATCGTAAGTATTTATCTAGCTCAAACCGA
GGCTTCAATGGCAGAACGAAATGATGCGATAGTTAAAATTGGTCGTTCAATTTTTGAAGTTTATACATCACAGTCGCGCT
GATAAGG

>>MEG_1521|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAGTTTTTATTGGCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACA
AGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGG
ATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAG
CAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCA
AGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCC
TAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATT
GAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGCACGTTAAATCA
ATTATTATTTGGTTCCACATTATCTGAAGCTAGTCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTTACGGGTA
ATTTATTGAGGTCAGTATTGCCAGTGAAGTGGAGTATTGCTGATCGCTCAGGAGCAGGTGGATTTGGTGCTAGGAGTATT
ACAGCGATTGTGTGGAGTGAAGAAAAAAAAACGATTATCGTAAGTATTTATCTAGCTCAAACCGAGGCTTCAATGGCAGA
ACGAAATGATGCGATAGTTAAAATTGGTCGTTCAATTTTTGAAGTTTATACATCACAGTCGCGCTGA

>>MEG_1522|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAACGTACGTAAACACAAGGCTAGTTTTTTTAGCGTAGTAATTACTTTTTTATGTCTCACGCTATCATTAAATGCTAA
TGCAACAGACTCAGTACTTGAAGCGGTTACCAATGCTGAAACTGAATTAGGCGCTAGAATTGGTCTAGCTGTGCATGATT
TGGAAACGGGAAAACGTTGGGAACATAAATCTAATGAACGTTTTCCTCTAAGTAGTACCTTTAAAACACTTGCCTGTGCA
AACGTTCTTCAAAGAGTTGATCTAGGTAAAGAAAGAATTGATAGAGTTGTGAGATTCTCTGAAAGCAATCTCGTTACATA
CTCACCTGTAACAGAAAAACATGTGGGTAAAAAAGGGATGTCGCTCGCAGAGCTGTGTCAGGCCACATTATCAACCAGTG
ATAATTCAGCTGCCAATTTTATTCTACAAGCGATTGGTGGACCTAAGGCTCTAACGAAATTTTTGCGTTCCATTGGCGAC
GATACTACGCGCCTTGATCGCTGGGAAACAGAACTTAACGAAGCGGTGCCTGGAGATAAGCGAGACACGACAACACCAAT
TGCAATGGTAACGACACTTGAAAAGTTACTAATTGACGAAACACTATCTATCAAATCTCGTCAACAACTAGAATCTTGGC
TTAAAGGTAATGAGGTTGGCGATGCATTGTTTCGTAAAGGCGTTCCAAGTGACTGGATAGTAGCAGATAGAACAGGCGCT
GGTGGTTATGGGTCGCGTGCTATTACTGCGGTGATGTGGCCTCCAAATCGCAAGCCTATCGTAGCCGCTCTATACATTAC
AGAGACAGACGCCTCGTTTGAAGAAAGAAATGCTGTCATTGCAAAAATTGGTGAGCAAATAGCGAAGACAGTATTAATGG
AGAATAGCCGTAACTGA

>>MEG_1523|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAGTTTTTATTGGCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACA
AGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGG
ATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAG
CAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCA
AGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCC
TAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATT
GAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATAA
ATTTTTATTTGGTTCCGCGCTATCTGAAATGAACCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTA
ATTTACTACGTTCAGTATTGCCGGCGGGATGGAACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATT
ACAGCAGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGAAGA
GCGAAATGATGCGATTGTTAAAATTGGTCATTCAATTTTTGACGTTTATACATCACAGTCGCGCTGA

>>MEG_1524|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAGTCTTTGTTGGTATTTGCGCTTTTAATGCCATCTGTAGTTTTTGCAAGCAGTTCAAAATTTCAATCAGTTGAACA
AGAAATTAAGGGAATTGAGTCTTCACTCTCTGCTCGTATAGGAGTCGCCATTTTGGATACTCAAAATGGCGAAAGCTGGG
ATTATAATGGTGATCAACGATTTCCATTAACAAGTACTTTCAAAACAATAGCTTGTGCTAAGTTGCTGTATGATGCAGAG
CATGGGAAAGTTAATCTCAATAGTACAGTTGAGATTAAGAAAGCAGATCTTGTTACGTATTCGCCTGTATTAGAAAAGCA
AGTAGGTAAACCAATAACGCTCTCTGATGCATGCCTTGCTACTATGACAACAAGCGACAATACAGCAGCCAATATTGTTA
TAAATGCTGTCGGTGATCCTAAAAGCATTACTGATTTTCTGAGACAAATTGGTGACAAAGAAACTCGTCTAGATCGTGTC
GAGCCTGAGCTCAATGAAGGTAAACTCGGTGATTTGAGGGATACGACAACGCCTAATGCAATAACCAGCACGTTAAATCA
ATTATTATTTGGTTCCACATTATCTGAAGCTAGTCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTTACGGGTA
ATTTATTGAGGTCAGTATTGCCAGTGAAGTGGAGTATTGCTGATCGCTCAGGAGCAGGTGGATTTGGTGCTAGGAGTATT
ACAGCGATTGTGTGGAGTGAAGAAAAAAAACCGATTATCGTAAGTATTTATCTAGCTCAAACCGAGGCTTCAATGGCAGA
ACGAAATGATGCGATAGTTAAGATTGGTCGTTCAATTTTTGAAGTTTATACATCACAGTCGCGTTGA

>>MEG_1525|Drugs|betalactams|Class_A_betalactamases|CARB
ATGGACGTACGTAAACACAAGGCTAGTTTTTTTAGCGTAGTAATTACTTTTTTATGTCTCACGCTATCATTAAATGCTAA
TGCAACAGACTCAGTACTTGAAGCGGTTACCAATGCTGAAACTGAATTAGGCGCTAGAATTGGTCTAGCTGTGCATGATT
TGGAAACGGGAAAACGTTGGGAACATAAATCTAATGAACGTTTTCCTCTAAGTAGTACCTTTAAAACACTTGCCTGTGCA
AACGTTCTTCAAAGAGTTGATCTAGGTAAAGAAAGAATTGATAGAGTTGTGAGATTCTCTGAAAGCAATCTCGTTACATA
CTCACCTGTAACAGAAAAACATGTGGGTAAAAAAGGGATGTCGCTCGCAGAGCTGTGTCAGGCCACATTATCAACCAGTG
ATAATTCAGCTGCCAATTTTATTCTACAAGCGATTGGTGGACCTAAGGCTCTAACGAAATTTTTGCGTTCCATTGGCGAC
GATACTACGCGCCTTGATCGCTGGGAAACAGAACTTAACGAAGCGGTGCCTGGAGATAAGCGAGACACGACAACACCAAT
TGCAATGGTAACGACACTTGAAAAGTTACTAATTGACGAAACACTATCTATCAAATCTCGTCAACAACTAGAATCTTGGC
TTAAAGGTAATGAGGTTGGCGATGCATTGTTTCGTAAAGGCGTTCCAAGTGACTGGATAGTAGCAGATAGAACAGGTGCT
GGTGGTTATGGGTCGCGTGCTATTACTGCGGTGATGTGGCCTCCAAATCGCAAGCCTATCGTAGCCGCTCTATACATTAC
AGAGACAGACGCCTCGTTTGAAGAAAGAAATGCTGTCATTGCAAAAATTGGTGAGCAAATAGCGAAGACAATATTAATGG
AGAATAGCCGTAACTGA

>>MEG_1526|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAGTCTTTGTTGGTATTTGCGCTTTTAATGCCATCTGTAGTTTTTGCAAGCAGTTCAAAATTTCAATCAGTTGAACA
AGAAATTAAGGGAATTGAGTCTTCACTCTCTGCTCGTATAGGAGTTGCCATTTTGGATACTCAAAATGGCGAAAGCTGGG
ATTATAATGGTGATCAACGATTTCCATTAACAAGTACTTTCAAAACAATAGCTTGTGCTAAGTTGCTGTATGATGCAGAG
CATGGGAAAGTTAATCTCAATAGTACAGTTGAGGTTAAGAAAGCAGATCTTGTTACGTATTCGCCTGTATTAGAAAAGCA
AGTAGGTAAACCAATAACGCTCTCTGATGCATGCTTTGCTACTATGACAACAAGCGACAATACAGCAGCCAATATTGTTA
TAAATGCTGTGGGTGATCCTAAAAGCATTACTGATTTTCTGAGACAAATTGGTGACAAAGAAACTCGTCTAGATCGTGTC
GAGCCTGAGCTCAATGAAGGTAAACTCGGTGATTTGAGGGATACGACAACGCCTAATGCAATAACCAGCACGTTAAATCA
ATTATTATTTGGTTCCACATTATCTGAAGCTAGTCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTTACGGGTA
ATTTATTGAGGTCAGTATTGCCAGTGACGTGGAGTATTGCTGATCGCTCAGGGGCAGGTGGATTTGGTGCTAGGAGTATT
ACAGCGATTGTGTGGAGTGAAGAAAAAAAACCGATTATCGTAAGTATTTATCTAGCTCAAACCGAGGCTTCAATGGCAGA
ACGAAATGATGCGATAGTTAAGATTGGTCGTTCAATTTTTGAAGTTTATACATCACAGTCGCGTTGA

>>MEG_1527|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAAAAGTTATTCCTGTTGGTTGGGCTGATGGTTTGCTCAACTGTTAGTTACGCCTCCAAATTAAACGAAGACATCTC
CCTCATCGAGAAACAAACATCTGGGCGAATTGGAGTGTCAGTCTGGGATACACAAACGGACAAGCGTTGGGATTATCGCG
GAGACGAACGTTTCCCATTAATGAGCACATTCAAAACGTTAGCGTGTGCCACCATGCTAAGCGACATGGACAGCGGCAAA
CTCAACAAAAATGCCACAGCGAAAATCGATGAACGCAATATTGTGGTTTGGTCTCCGGTGATGGATAAACTGGCTGGACA
AAGCACACGCATCGAACACGCTTGTGAAGCCGCCATGTTGATGAGCGACAACACCGCCGCGAACTTAGTGTTAAATGAAA
TTGGTGGTCCTAAAGCGGTCACGCAGTTTTTGCGATCTATTGGCGACAAAGCAACGCGACTTGACCGATTGGAACCCCGT
TTGAATGAAGCAAAACCGGGCGACAAGCGAGACACCACAACGCCTAACGCCATGGTAAACACCCTACACACCTTGATGGA
AGATAACGCCCTATCTTACGAGTCACGCACACAGCTGAAAATCTGGATGCAAGACAACAAAGTATCGGATTCTCTCATGC
GCTCTGTTCTGCCAAAAGGCTGGTCGATTGCAGACCGCTCTGGCGCAGGTAACTACGGTTCACGCGGCATTAGCGCGATG
ATCTGGAAAGACAACTACAAGCCGGTTTACATCAGTATTTACGTCACAGACACAGACCTTTCGCTTCAAGCTCGCGATCA
ACTGATCGCGCAAATCAGCCAACTGATTTTAGAGCACTACAAAGAAAGTTAA

>>MEG_1528|Drugs|betalactams|Class_A_betalactamases|CARB
GTGGTTAGAGTATTCACTCGTTATAGTTTGCTTAACATCGCCAAAGTGCGAATCAAAACCAAAAGAACGAAGAACACACG
CATGAAAAAGTTATTCCTGTTGGTTGGGCTGATGGTTTGCTCAACTGTTAGTTACGCTTCCAAATTAAACGAAGACATCT
CCCTCATCGAGAAACAAACATCTGGGCGAATTGGAGTGTCAGTCTGGGATACACAAATGGACGAGCGTTGGGATTATCGC
GGAGACGAACGTTTCCCATTAATGAGCACATTCAAAACGTTAGCGTGTGCCACCATGCTAAGCGACATGGACAGCGGCAA
ACTCAACAAAAATGCCACAGCGAGAATCGATGAACGCAATATTGTGGTTTGGTCTCCGGTGATGGATAAACTGGCTGGAC
AAAGCACGCGTATCGAACACGCTTGTGAAGCCGCCATGTTGATGAGCGACAACACCGCCGCAAACTTAGTGCTAAATGAA
ATTGGTGGTCCTAAAGCGGTCACGCTGTTTTTGCGCTCTATTGGCGACAAAGCAACGCGACTTGACCGATTGGAGCCCCG
TTTGAACGAAGCAAAACCGGGCGACAAGCGAGACACCACAACGCCTAACGCCATGGTAAACACCCTACACACCTTGATGG
AAGATAACGCCCTATCTTACGAGTCACGCACACAGCTGAAAATCTGGATGCAAGACAACAAAGTATCGGATTCTCTCATG
CGCTCTGTTCTACCAAAAGGCTGGTCGATTGCAGACCGCTCTGGCGCAGGTAACTACGGTTCACGCGGCATTAGCGCGAT
GATTTGGAAAGACAACTACAAGCCGGTTTACATCAGTATTTACGTCACAGATACTGACCTTTCGCTTCAAGCTCGCGATC
AACTGATCGCGCAAATCAGCCAACTGATTTTAGAGCACTACAAAGAAAGTTAA

>>MEG_1529|Drugs|betalactams|Class_A_betalactamases|CARB
GTGGTTAGAGTATTCACTCGTTATAGTTTGCTTAACATCGCCAAAGTGCGAATCAAAACCAAAGAACGAAGAACACCACG
CATGAAAAAGTTATTCCTGTTGGTTGGGCTGATGGTTTGCTCAACTGTTAGTTACGCCTCCAAATTAAATTTAAATGAAG
ACATCTCCCTCATCGAGAAACAAACATCTGGGCGAATTGGAGTGTCAGTCTGGGATACACAAACGGACGAGCGTTGGGAT
TATCGCGGAGACGAACGTTTCCCATTAATGAGCACATTTAAAACGTTAGCGTGTGCCACCATGCTAAGCGACATGGACAG
CGGCAAACTCAACAAAAATGCCACAGCGAAAATCGATGAACGCAATATTGTGGTTTGGTCTCCGGTGATGGATAAACTGG
CTGGACAAAGTACACGTATCGAACACGCTTGTGAGGCCGCCATGTTGATGAGCGACAACACCGCCGCGAACTTAGTGCTA
AATGAAATTGGTGGTCCTAAAGCGGTCACACTGTTTTTGCGCTCTATTGGCGACAAAGCAACGCGACTTGACCGATTGGA
GCCCCGTTTGAATGAAGCAAAACCGGGCGACAAGCGAGACACCACAACGCCTAACGCCATGGTAAACACCCTACACACCT
TGATGGAAGATAACGCCCTATCTTACGAGTCACGCACACAGCTGAAAATCTGGATGCAAGACAACAAAGTATCGGATTCT
CTCATGCGCTCTGTTCTGCCAAAAGGCTGGTCGATTGCAGACCGCTCTGGCGCAGGTAACTACGGTTCACGCGGCATTAG
CGCGATGATTTGGAAAGACAACTACAAGCCGGTTTACATCAGTATTTACGTCACAGACACTGACCTTTCGCTTCAAGCTC
GCGATCAACTGATCGCGCAAATCAGCCAACTGATTTTAGAGCACTACAAAGAAAGTTAA

>>MEG_1530|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAAAAGTTATTCCTGTTGGTTGGGCTGATGGTTTGCTCAACTGTTAGTTACGCCTCCAAATTAAACGAAGACATCTC
CCTCATCGAGAAACAAACATCTGGGCGAATTGGAGTGTCAGTCTGGGATACACAAACGGACGAGCGTTGGGATTATCGCG
GAGACGAACGTTTCCCATTAATGAGCACATTCAAAACGTTAGCGTGTGCCACCATGCTAAGCGACATGGACAGCGGCAAA
CTCAACAAAAATGCCACAGCGAGAATCGATGAACGCAATATTGTGGTTTGGTCTCCGGTGATGGATAAACTGGCTGGACA
AAGCACGCGTATCGAACACGCTTGTGAAGCCGCCATGTTGATGAGCGACAACACCGCCGCAAACTTAGTGCTAAATGAAA
TTGGTGGTCCTAAAGCGGTCACGCTGTTTTTGCGCTCTATTGGCGACAAAGCAACGCGGCTTGACCGATTGGAGCCCCGT
TTGAACGAAGCAAAACCGGGCGACAAGCGAGACACCACAACGCCTAACGCCATGGTAAACACCCTACACACCTTGATGGA
AGATAACGCCCTATCTTACGAGTCACGCACACAGCTGAAAATCTGGATGCAAGACAACAAAGTATCGGATTCTCTCATGC
GCTCTGTTCTGCCAAAAGGCTGGTCGATTGCAGACCGCTCTGGCGCAGGTAACTACGGTTCACGCGGCATTAGCGCGATG
ATTTGGAAAGACAACTACAAGCCAGTTTACATCAGTATTTACGTCACAGATACTGACCTTTCGCTTCAAGCTCGCGATCA
ACTGATCGCGCAAATCAGCCAACTGATTTTAGAGCACTACAAAGAAAGTTAA

>>MEG_1531|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAGTTTTTATTGGTATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCGGCAAGTTGAACA
AGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATACTGGG
ATTACAATGGCAATCAGCGCTTCCCGTTGACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAG
CAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCA
AGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCC
TAAGTGCTGTAGGTGGCTCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATT
GAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATAA
ATTTTTATTTGGTTCAGCGCTATCTGAAATGAACAAAAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTA
ATTTACTACGTTCAGTATTGCCGGCGGGATGGAACATTGCGGATCGTTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATT
ACAGCAGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGA
GCGAAATGATGCGATTGTTAAAATTGGTCGTTCAATTTTTGACGTTTATACATCACAGTCGCGCTGA

>>MEG_1532|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAGTTTTTATTGGCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACA
AGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGG
ATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAG
CAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATTAAGAAAACAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCA
AGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCC
TAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATT
GAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATAA
ATTTTTATTTGGTTCCGCGCTATCTGAAATGAACCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTA
ATTTACTACGTTCAGTATTGCCGGCGGGACGGAACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATT
ACAGCAGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGA
GCGAAATGATGCGATTGTTAAAATTGGTCATTCAATTTTTGACGTTTATACATCACAGTCGCGCTGA

>>MEG_1533|Drugs|betalactams|Class_A_betalactamases|CARB
ATGGACGTACGTCAACACAAGGCTAGTTTTTTTAGCGTAGTAATTACTTTTTTATGTCTCACGCTATCATTAAATGCTAA
TGCAACAGACTCAGTACTTGAAGCGGTTACCAATGCTGAAACTGAATTAGGCGCTAGAATTGGTCTAGCTGCGCATGATT
TGGAAACGGGAAAACGTTGGGAACATAAATCTAATGAACGTTTTCCTCTAACTAGTACCTTTAAAACACTTGCCTGTGCA
AACGTTCTTCAAAGAGTTGATCTAGGTAAAGAAAGAATTGATAGAGTTGTGAGATTCTCTGAAAGCAATCTCGTTACATA
CTCACCTGTAACAGAAAAACATGTGGGTAAAAAAGGGATGTCGCTCGCAGAGCTGTGTCAGGCCACATTATCAACCAGTG
ATAATTCAGCTGCCAATTTTATTCTACAAGCGATTGGGGGACCTAAGGCTCTAACGAAATTTTTGCGTTCCATTGGCGAC
GATACTACGCGCCTTGATCGCTGGGAAACAGAACTTAACGAAGCGGTGCCTGGAGATAAGCGAGACACGACAACACCAAT
TGCAATGGTAACGACACTTGAAAAGTTACTAATTGACGAAACACTATCTATCAAATCTCGTCAACAACTAGAATCTTGGC
TTAAAGGTAATGAGGTTGGCGATGCATTGTTTCGTAAAGGCGTTCCAAGTGACTGGATAGTAGCAGATAGAACAGGCGCT
GGTGGTTATGGGTCGCGTGCTATTACTGCGGTGATGTGGCCTCCAAATCGCAAGCCTATCGTAGCCGCTCTATACATTAC
AGAGACAGACGCCTCGTTTGAAGAAAGAAATGCTGTCATTGCAAAAATTGGTGAGCAAATAGCGAAGACAGTATTAATGG
AGAATAGCCGTAACTGA

>>MEG_1534|Drugs|betalactams|Class_A_betalactamases|CARB
ATGGACGTACGTAAACACAAGGCTAGTTTTTTTAGCGTAGTAATTACTTTTTTATGTCTCACGCTATCATTAAATGCTAA
TGCAACAGACTCAGTACTTGAAGCGGTTACCAATGCTGAAACTGAATTAGGCGCTAGAATTGGTCTAGCTGTGCATGATT
TGGAAACGGGAAAACGTTGGGAACATAAATCTAATGAACGTTTTCCTCTAAGTAGTACCTTTAAAACACTTGCCTGTGCA
AACGTTCTTCAAAGAGTTGATCTAGGTAAAGAAAGAATTGATAGAGTTGTGAGATTCTCTGAAAGCAATCTCGTTACATA
CTCACCTGTAACAGAAAAACATGTGGGTAAAAAAGGGATGTCGCTCGCAGAGCTGTGTCAGGCCACATTATCAACCAGTG
ATAATTCAGCTGCCAATTTTATTCTACAAGCGATTGGTGGACCTAAGGCTCTAACGAAATTTTTGCGTTCCATTGGCGAC
GATACTACGCGCCTTGATCGCTGGGAAACAGAACTTAACGAAGCGGTACCTGGAGATAAGCGAGACACGACAACACCAAT
TGCAATGGTAACGACACTTGAAAAGTTACTAATTGACGAAACACTATCTATCAAATCTCGTCAACAACTAGAATCTTGGC
TTAAAGGTAATGAGGTTGGCGATGCATTGTTTCGTAAAGGCGTTCCAAGTGACTGGATAGTAGCAGATAGAACAGGCGCT
GGTGGTTATGGGTCGCGTGCTATTACTGCGGTGATGTGGCCTCCAAATCGCAAGCCTATCGTAGCCGCTCTATACATTAC
AGAGACAGACGCCTCGTTTGAAGAAAGAAATGCTGTCATTGCAAAAATTGGTGAGCAAATAGCGAAGATAGTATTAATGG
AGAATAGCCGTAACTGA

>>MEG_1535|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAAAAGTTATTCCTGTTGGTTGGGCTGATGGTTTGCTCAACTGTTAGTTACGCCTCCAAATTAAACGAAGACATCTC
CCTCATCGAGAAACAAACATCTGGGCGAATTGGAGTGTCAGTCTGGGATACACAAACGGACGAGCGTTGGGATTATCGCG
GAGACGAACGCTTCCCATTAATGAGCACATTCAAAACGTTAGCGTGTGCCACCATGCTAAGCGACATGGACAGCGGCAAA
CTCAACAAAAATGCCACAGCGAGAATCGATGAACGCAATATTGTGGTTTGGTCTCCGGTGATGGATAAACTGACTGGACA
AAGCACACGTATCGAACACGCTTGTGAAGCCGCCATGTTGATGAGCGACAACACCGCCGCGAACTTAGTGCTAAATGAAA
TTGGTGGTCCTAAAGCGGTCACACTGTTTTTGCGCTCTATTGGCGACAAAGCAACGCGACTTGACCGATTGGAACCCCGT
TTGAATGAAGCAAAACCGGGCGACAAGCGAGATACCACAACGCCTAACGCCATGGTAAACACCCTACATACCTTGATGGA
AGATAACGCCCTATCTTACGAGTCACGCACACAGCTGAAAATCTGGATGCAAGACAACAAAGTATCGGATTCGCTCATGC
GCTCTGTTCTGCCAAAAGGCTGGTCGATTGCAGACCGCTCTGGCGCAGGTAACTACGGTTCACGCGGCATTAGCGCGATG
ATCTGGAAAGACAACTACAAGCCAGTTTACATCAGTATTTACGTCACAGACACCGACCTTTCGCTTCAAGCTCGCGATCA
ACTGATCGCGCAAATCAGCCAACTGATTTTAGAGCACTACAAAGAAAGTTAA

>>MEG_1536|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAAAAGTTATTCCTGTTGGTTGGGCTGATGGTTTGCTCAACTGTTAGTTACGCCTCCAAATTAAACGAAGACATCTC
CCTCATCGAGAAACAAACATCTGGGCGAATTGGAGTGTCAGTCTGGGATACACAAACGGACGAGCGTTGGGATTATCGCG
GAGACGAACGTTTCCCATTAATGAGCACATTCAAAACGTTAGCGTGTGCCACCATGCTAAGCGACATGGACAGCGGCAAA
CTCAACAAAAATGCCACAGCGAAAATCGATGAACGCAATATTGTGGTTTGGTCTCCGGTGATGGATAAACTGGCTGGACA
AAGCACACGYATCGAACACGCTTGTGAAGCCGCCATGTTGATGAGCGACAACACCGCCGCGAACTTAGTGCTAAATGAAA
TTGGTGGTCCTAAAGCGGTCACGCTGTTTTTGCGATCTATTGGCGACAAAGCAACGCGACTTGACCGATTGGAACCCCGT
TTGAATGAAGCAAAACCGGGCGACAAGCGAGACACCACAACGCCTAACGCCATGGTAAACACCCTACATACCTTGATGGA
AGATAACGCCCTATCTTACGAGTCACGCACACAGCTGAAAATCTGGATGCAAGACAACAAAGTATCGGATTCKCTCATGC
GCTCTGTTCTGCCAAAAGGCTGGTCGATTGCAGACCGCTCTGGCGCAGGTAACTACGGTTCACGCGGCATTAGCGCGATG
ATCTGGAAAGACAACTACAAGCCGGTTTACATCAGTATTTACGTCACAGACACTGACCTTTCGCTTCAAGCTCGCGATCA
ACTGATCGCGCAAATCAGCCAACTGATTTTAGAGCACTACAAAGAAAGTTAG

>>MEG_1537|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAAAAGTTATTCCTGTTGGCTGGGCTGATGGTTTGCTCAACTGTTAGTTACGCCTCCAAATTAAACGAAGACATATC
CCTCATCGAGAAACAAACATCTGGGCGAATTGGAGTGTCAGTCTGGGATACACAAACGGACGAGCGTTGGGATTATCGCG
GAGACGAACGTTTCCCATTAATGAGCACATTCAAAACGTTAGCGTGTGCCACCATGCTAAGCGATATGGACAGCGGCAAA
CTCAACAAAAATGCTACAGCGAAAATCGATGAACGCAATATTGTGGTTTGGTCTCCGGTGATGGATAAACTGGCTGGACA
AAGCACACGTATCGAACACGCTTGTGAGGCCGCCATGTTGATGAGCGACAACACCGCCGCGAACTTAGTGCTAAATGAAA
TTGGTGGTCCTAAAGCGGTCACGCTGTTTTTGCGATCTATTGGCGACAAAGCAACGCGACTTGACCGATTGGAACCCCGT
TTGAATGAAGCAAAACCGGGCGATAAGCGAGACACCACAACGCCTAACGCCATGGTAAACACCCTACATACCTTGATGGA
AGATAACGCCCTATCTTACGAGTCACGCACACAGCTGAAAATCTGGATGCAAGATAACAAAGTATCGGATTCTCTCATGC
GCTCCGTTCTACCAAAAGGCTGGTCGATTGCAGACCGCTCTGGCGCAGGTAACTACGGTTCACGCGGCATTAGCGCGATG
ATCTGGAAAGACAACTACAAGCCGGTTTACATCAGTATTTACGTCACAGACACCGACCTTTCGCTTCAAGCTCGCGATCA
ACTGATCGCGCAAATCAGCCAACTGATTTTAGAGCACTACAAAGAAAGTTAG

>>MEG_1538|Drugs|betalactams|Class_A_betalactamases|CARB
ATGCTTTTATATAAAATGTGTGACAATCAAAATTATGGGGTTACTTACATGAAGTTTTTATTGGCATTTTCGCTTTTAAT
ACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACAAGACGTTAAGGCAATTGAAGTTTCTCTTTCTG
CTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGGATTACAATGGCAATCAGCGCTTCCCGTTAACA
AGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAGCAAGGAAAAGTTAATCCCAATAGTACAGTCGA
GATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCAAGTAGGGCAGGCAATCACACTCGATGATGCGT
GCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCCTAAGTGCTGTAGGTGGCCCCAAAGGCGTTACT
GATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATTGAGCCTGATTTAAATGAAGGTAAGCTCGGTGA
TTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATAAACTTTTATTTGGTTCCGCGCTATCTGAAATGA
ACCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTAATTTACTACGTTCAGTATTGCCGGCGGGATGG
AACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATTACAGCAGTTGTGTGGAGTGAGCATCAAGCCCC
AATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGAGCGAAATGATGCGATTGTTAAAATTGGTCATT
CAATTTTTGACGTTTATACATCACAGTCGCGCTGA

>>MEG_1539|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAGCTTTTACTGGTATTTTCGCTTTTAATACCGTCTATGGTGTTTGCAAATAGTTCAAAGTTTCAACAGGTTGAACA
AGATGCTAAGGTAATTGAAGCATCTCTTTCTGCGCATATAGGGATTTCTGTTCTTGATACTCAAACTGGAGAGTATTGGG
ATTACAATGGCAATCAGCGTTTTCCTTTGACAAGTACTTTTAAAACAATAGCTTGTGCTAAATTATTATATGATGCTGAG
CAAGGGGAAATAAACCCTAAGAGTACAATTGAGATCAAAAAAGCAGATCTTGTGACCTATTCTCCCGTAATAGAAAAGCA
AGTAGGACAAGCAATAACGCTCGATGATGCGTGTTTTGCAACTATGACGACAAGTGATAATGCAGCAGCAAATATCATCC
TAAATGCCCTAGGAGGTCCTGAAAGCGTGACGGATTTTCTAAGACAAATCGGAGATAAAGAAACCCGTCTAGACCGTATT
GAACCTGAATTAAATGAAGGCAAGCTTGGTGATTTGAGGGATACGACAACTCCTAATGCAATAGTGAATACTTTAAATGA
ATTATTATTTGGTTCCACATTGTCTCAAGATGGCCAGAAAAAATTAGAGTATTGGATGGTGAATAATCAAGTCACTGGTA
ATTTATTGCGGTCAGTATTGCCAGAGGGATGGAATATTGCGGATCGTTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATT
ACAGCCGTTGTTTGGAGTGAAGCTCAATCCCCAATCATAGTTAGTATCTATCTAGCGCAAACAGAGGCTTCAATAGCAGA
TCGAAATGATGCAATTGTTAAAATTGGTCGTTCAATTTTTGAAGTTTATTCATCACAATCGCGTTGA

>>MEG_1540|Drugs|betalactams|Class_A_betalactamases|CARB
ATGCTTTTATATAAAATGTGTGACAATCAAAATTATGGGGTTACTTACATGAAGTTTTTATTGGCATTTTCGCTTTTAAT
ACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACAAGACGTTAAGGCAATTGAAGTTTCTCTTTCTG
CTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGGATTACAATGGCAATCAGCGCTTCCCGTTAACA
AGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAGCAAGGAAAAGTTAATCCCAATAGTACAGTCGA
GATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCAAGTAGGGCAGGCAATCACACTCGATGATGCGT
GCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCCTAAGTGCTGTAGGTGGCCCCAAAGGCGTTACT
GATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATTGAGCCTGATTTAAATGAAGGTAAGCTCGGTGA
TTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATAAATTTTTATTTGGTTCCGCGCTATCTGAAATGA
ACCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTAATTTACTACGTTCAGTATTGCCGGCGGGATGG
AACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATTACAGCAGTTGTGTGGAGTGAGCATCAAGCCCC
AATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGAGCGAAATGATGCGATTGTTAAAATTGGTCATT
CAATTTTTGACGTTTATACATCACAGTCGCGCTGA

>>MEG_1541|Drugs|betalactams|Class_A_betalactamases|CARB
ATGGACGTACGTAAACACAAGGCTAGTTTTTTTAGCGTAGTAATTACTTTTTTATGTCTCACGCTATCATTAAATGCTAA
TGCAACAGACTCAGTACTTGAAGCGGTTACCAATGCTGAAACTGAATTAGGCGCTAGAATTGGTCTAGCTGTGCATGATT
TGGAAACGGGAAAACGTTGGGAACATAAATCTAATGAACGTTTTCCTCTAAGTAGCACCTTTAAAACACTTGCCTGTGCA
AACGTTCTTCAAAGAGTTGATCTAGGTAAAGAAAGAATTGATAGAGTTGTGAGATTCTCTGAAAGCAATCTCGTTACATA
CTCACCTGTAACAGAAAAACATGTGGGTAAAAAAGGGATGTCGCTCGCAGAGCTGTGTCAGGCCACATTATCAACCAGTG
ATAATTCAGCTGCCAATTTTATTCTACAAGCGATTGGTGGACCTAAGGCTCTAACGAAATTTTTGCGTTCCATTGGCGAC
GATACTACGCGCCTTGATCGCTGGGAAACAGAACTTAACGAAGCGGTGCCTGGAGATAAGCGAGACACGACAACACCAAT
TGCAATGGTAACGACACTTGAAAAGTTACTAATTGACGAAACACTATCTATCAAATCTCGTCAACAACTAGAATCTTGGC
TTAAAGGTAATGAGGTTGGCGATGCATTGTTTCGTAAAGGCGTTCCAAGTGACTGGATAGTAGCAGATAGAACAGGCGCT
GGTGGTTATGGGTCGCGTGCTATTACTGCGGTGATGTGGCCTCCAAATCGCAAGCCTATCGTAGCCGCTCTATACATTAC
AGAGACAGACGCCTCGTTTGAAGAAAGAAATGCTGTCATTGCAAAAATTGGTGAGCAAATAGCGAAGACAGTATTAATGG
AGAATAGCCGTAACTGA

>>MEG_1542|Drugs|betalactams|Class_A_betalactamases|CARB
TCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGG
GCAGTCGCCCTAAAACAAAGTTAGCCATATTATGGAGCCTCATGCTTTTATATAAAATGTGTGACAATCAAAATTATGGG
GTTACTTACATGAAGTTTTTATTGGCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCA
AGTTGAACAAGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAG
AATATTGGGATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATAT
GATGCTGAGCAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAAT
AGAAAAGCAAGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAA
ATATCATCCTAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTA
GACCGTATTGAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTAC
TTTGAATAAACTTTTATTTGGTTCCGCGCTATCTGAAATGAACCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAG
TCACTGGTAATTTACTACGTTCAGTATTGCCGGCGGGATGGAACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCT
CGGAGTATTACAGCAGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTC
AATGGCAGAGCGAAATGATGCGATTGTTAAAATTGGTCATTCAATTTTTGACGTTTATACATCACAGTCGCGCTGATAAG
GCTAACAAGGCCATCAAGTT

>>MEG_1543|Drugs|betalactams|Class_A_betalactamases|CARB
ATTTCAGTGCCTAATGCTTTAAGTTAAGATGTATGCCAATCAATATTATGGGGTCACATACATGAAGTCTTTGTTGGTAT
TTGCGCTTTTAATGCCATCTGTAGTTTTTGCAAGCAGTTCAAAATTTCAATCAGTTGAACAAGAAATTAAGGGAATTGAG
TCTTCACTCTCTGCTCGTATAGGAGTTGCCATTTTGGATACTCAAAATGGCGAAAGCTGGGATTATAATGGTGATCAACG
ATTTCCATTAACAAGTACTTTCAAAACAATAGCTTGTGCTAAGTTGCTGTATGATGCAGAGCATGGGAAAGTTAATCTCA
ATAGTACAGTTGAGGTTAAGAAAGCAGATCTTGTTACGTATTCGCCTGTATTAGAAAAGCAAGTAGGTAAACCAATAACG
CTCTCTGATGCATGCTTTGCTACTATGACAACAAGCGACAATACAGCAGCCAATATTGTTATAAATGCTGTGGGTGATCC
TAAAAGCATTACTGATTTTCTGAGACAAATTGGTGACAAAGAAACTCGTCTAGATCGTGTCGAGCCTGAGCTCAATGAAG
GTAAACTCGGTGATTTGAGGGATACGACAACGCCTAATGCAATAACCAGCACGTTAAATCAATTATTATTTGGTTCCACA
TTATCTGAAGCTAGTCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTTACGGGTAATTTATTGAGGTCAGTATT
GCCAGTGACGTGGAGTATTGCTGATCGCTCAGGGGCAGGTGGATTTGGTGCTAGGAGTATTACAGCGATTGTGTGGAGTG
AAGAAAAAAAACCGATTATCGTAAGTATTTATCTAGCTCAAACCGAGGCTTCAATGGCAGAACGAAATGATGCGATAGTT
AAGATTGGTCGTTCAATTTTTGAAGTTTATACATCACAGTCGCGTTGA

>>MEG_1544|Drugs|betalactams|Class_A_betalactamases|CARB
GGATCCCGAGTTCTGGCCCGACGCCCTCAAGGGGGAGGCCGCATATCTGCACAAGCTCGCGGTGCGACGGACACATGCGG
GCCGGGGTGTCAGCTCCGCGCTGATCGAGGCTTGCCGCCATGCCGCGCGAACGCAGGGGTGCGCCAAGCTGCGGCTCGAC
TGCCACCCGAACCTGCGTGGCCTATACGAGCGGCTCGGATTCACCCACGTCGAGGCAATGGTTGAAATGCTCGGCGGGCG
CGTCACGGAGGAGTTGGACTATGGATTCTTAGCGGAGATCGGGGATGAGTTACTTGACTGCGAACCTGCTTGGTGGGCAG
ACGAAGCGTATGAAATCGCGGAGGCTCCGCAGGGCTCGTGCCCAGAGGCGGCTGAGGGCGTCATCGCCGGGCGGCCAGTC
CGTTGTAACAGCTGGGAGGCGATCATCTGGGATTACTTTTACTATGCCGATGAAGTACCACCAATGGACTGGCCTACAAA
GCACATAGAGTCCTACAGGCTCGCATGCACCTCACTCGGGGCGGAAAAGGTTGAGGTCTTGCGTGCCGCTTTCAGGTCGC
GATATGCGGCCTAACAATTCGTCCAAGCCGACGCCGCTTCGCGGCGCGGCTTAACTCAGGTGTTAGCCTTATTTGAATAC
TTCACACTCTGATATAAGATGTAAGCCAATCAAAATGATGAGGTTATTACATGAAGCTTTTACTGGTATTTTCGCTTTTA
ATACCGTCTATGGTGTTTGCAAATAGTTCAAAGTTTCAACAGGTTGAACAAGATGCTAAGGTAATTGAAGCATCTCTTTC
TGCGCATATAGGGATTTCTGTTCTTGATACTCAAACTGGAGAGTATTGGGATTACAATGGCAATCAGCGTTTTCCTTTGA
CAAGTACTTTTAAAACAATAGCTTGTGCTAAATTATTATATGATGCTGAGCAAGGGGAAATAAACCCTAAGAGTACAATT
GAGATCAAAAAAGCAGATCTTGTGACCTATTCTCCCGTAATAGAAAAGCAAGTAGGACAAGCAATAACGCTCGATGATGC
GTGTTTTGCAACTATGACGACAAGTGATAATGCAGCAGCAAATATCATCCTAAATGCCCTAGGAGGTCCTGAAAGCGTGA
CGGATTTTCTAAGACAAATCGGAGATAAAGAAACCCGTCTAGACCGTATTGAACCTGAATTAAATGAAGGCAAGCTTGGT
GATTTGAGGGATACGACAACTCCTAATGCAATAGTGAATACTTTAAATGAATTATTATTTGGTTCCACATTGTCTCAAGA
TGGCCAGAAAAAATTAGAGTATTGGATGGTGAATAATCAAGTCACTGGTAATTTATTGCGGTCAGTATTGCCAGAGGGAT
GGAATATTGCGGATCGTTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATTACAGCCGTTGTTTGGAGTGAAGCTCAATCC
CCAATCATAGTTAGTATCTATCTAGCGCAAACAGAGGCTTCAATAGCAGATCGAAATGATGCAATTGTTAAAATTGGTCG
TTCAATTTTTGAAGTTTATTCATCACAATCGCGTTGATAAGGCTAACAAAGCATTTAAGAGGGACAGCCAACGCGTGGCA
CTTTTATTATGCGTTGGTTTTTGTGGTTACGGTGTTATGCGGTAAGTTGGTAGTAGCGTTGGCTGCCCCTTAATGCGGCG
TTAGATGCACTAAGCACATAATTGCTCACAGCCAAACTATCAGGTCAAGTCTGCTTTTATTATTTTTAAGCGTGCATAAT
AAGCCCTACACAAATTGGGAGATATATCATGAAAGGCTGGCTTTTTCTTGTTATCGCAATAGTTGGCGAAGTAATCGCAA
CATCCGCATTAAAATCTAGCGAGGGCTTTACTAAGCTT

>>MEG_1545|Drugs|betalactams|Class_A_betalactamases|CARB
GTTAACCCATTATGAACGTACGTAAACACAAGGCTAGTTTTTTTAGCGTAGTAATTACTTTTTTATGTCTCACGCTATCA
TTAAATGCTAATGCAACAGACTCAGTACTTGAAGCGGTTACCAATGCTGAAACTGAATTAGGCGCTAGAATTGGTCTAGC
TGTGCATGATTTGGAAACGGGAAAACGTTGGGAACATAAATCTAATGAACGTTTTCCTCTAAGTAGTACCTTTAAAACAC
TTGCCTGTGCAAACGTTCTTCAAAGAGTTGATCTAGGTAAAGAAAGAATTGATAGAGTTGTGAGATTCTCTGAAAGCAAT
CTCGTTACATACTCACCTGTAACAGAAAAACATGTGGGTAAAAAAGGGATGTCGCTCGCAGAGCTGTGTCAGGCCACATT
ATCAACCAGTGATAATTCAGCTGCCAATTTTATTCTACAAGCGATTGGTGGACCTAAGGCTCTAACGAAATTTTTGCGTT
CCATTGGCGACGATACTACGCGCCTTGATCGCTGGGAAACAGAACTTAACGAAGCGGTGCCTGGAGATAAGCGAGACACG
ACAACACCAATTGCAATGGTAACGACACTTGAAAAGTTACTAATTGACGAAACACTATCTATCAAATCTCGTCAACAACT
AGAATCTTGGCTTAAAGGTAATGAGGTTGGCGATGCATTGTTTCGTAAAGGCGTTCCAAGTGACTGGATAGTAGCAGATA
GAACAGGCGCTGGTGGTTATGGGTCGCGTGCTATTACTGCGGTGATGTGGCCTCCAAATCGCAAGCCTATCGTAGCCGCT
CTATACATTACAGAGACAGACGCCTCGTTTGAAGAAAGAAATGCTGTCATTGCAAAAATTGGTGAGCAAATAGCGAAGAC
AGTATTAATGGAGAATAGCCGTAACTGATTTA

>>MEG_1546|Drugs|betalactams|Class_A_betalactamases|CARB
TTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAG
CCATATTATGGAGCCTCATGCTTTTATATAAAATGTGTGACAATCAAAATTATGGGGTTACTTACATGAAGTTTTTATTG
GCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACAAGACGTTAAGGCAAT
TGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGGATTACAATGGCAATC
AGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAGCAAGGAAAAGTTAAT
CCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCAAGTAGGGCAGGCAAT
CACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCCTAAGTGCTGTAGGTG
GCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATTGAGCCTGATTTAAAT
GAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATAAATTTTTATTTGGTTC
CGCGCTATCTGAAATGAACCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTAATTTACTACGTTCAG
TATTGCCGGCGGGATGGAACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATTACAGCAGTTGTGTGG
AGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGAGCGAAATGATGCGAT
TGTTAAAATTGGTCATTCAATTTTTGACGTTTATACATCACAGTCGCGCTGATAAGGCTAACAAGGCCATCAAGTTGACG
GCTTTTCCGTCGCTTGTTTTGTGGTTTAACGCTACGCTACCACAAAACAATCAACTCCAAAGCCGCAACTTATGGCG

>>MEG_1547|Drugs|betalactams|Class_A_betalactamases|CARB
ATGAAGTTTTTATTGGCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACA
AGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGG
ATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAG
CAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCA
AGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCC
TAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATT
GAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATAA
ATTTTTATTTGGTTCCGCGCTATCTGAAATGAACCAGAAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTA
ATTTACTACGTTCAGTATTGCCGGCGGGATGGAACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATT
ACAGCAGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGA
GCGAAATGATGCGATTGTTAAAATTGGTCATTCAATTTTTGACGTTTATACATCACAGTCGCGCTGATAA