MEGAResFrom MEG, the Microbial Ecology Group

BLAZ

the blaZ gene encodes a beta-lactamase.

References

Other Groups in Class A betalactamases

Sequences

Download Sequences

>CARD|phgb|NC_010066|9682-10528|ARO:3000621|PC1|betalactams|Class_A_betalactamases|BLAZ
TTAAAATTCCTTCATTACACTCTTGGCGGTTTCACTTATCAACTTATCATTTGGCTTATCACTTTTATTGTCTTTATTCG
TAAAAATGACTAAAACAATAGGTTCAGATTGGCCCTTAGGATAAACAAAAGCAACATCATTTCTAGAAGCATATGTTATT
GCTTGACCACTTTTATCAGCAACTTTATAGTCTTTTGGAATACCATCTTTAATTAAAGTGTCTCCGTTTTTATTATTTAA
CATTAAATCAAGTAAGAAATTTTTATTTTTTTTGCTTAATTTTCCATTTGCGATAAGTTTATTTAAAGTCTTGCCGAAAG
CAGCAGGCGTTGAAGTATCTTTTTTGCTCTTTGGTGAATAGTAATTTAATTCTATTTCATATCTAACTGGATTTGTTACT
TTATCTCCCAATTTTTTTAAACGTTTTTTAATTTTTTTGATTCCACCGATTTCGTTTATAATTTTATTGTTTGCTGTATT
ATCACTGTACTTCATTGAAGCCTCAATAAGTTCTTTTAAAGCGATATCTTTTCCTACATATTTTTCTAAAATAGGAGAAT
AAGCAACTATATCATCTTTGTTAATATGTACTTTTTTATTTAACTTATTATAAGGTACTTGTTCTAACAAAATAGCACTA
TTTATCGCTTTTGAAGTCGAAGCATAGGCAAATCTCTTATCTGAATTAAATTTTACTTCCTTACCACTTTTAGTATCTAA
AGCATAAACACCAATATGAGCATTATATTTTTTTTCTAAATCATTTAACTCTTTGGCATGTGAACTGTTTGAATTACATG
CACTTAAAACTAAAGCAATTACAATTAAAAATATTAACTTTTTCAAA

>Bla|BlaZ|AB245469|2235-3080|861|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>Bla|Z_32_AP004832|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>Bla|FR823292.1|gene2|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAATTAATAATTTTAGTCGTGTTAGCGTTGATATTAAGTGCTTGTAATAGTAAGAATTCAACTAATAACGACAT
TGAAAAGATCGAAAAAAAATATGGTGCTAACGTAGGTATGTATGCTCTTAATACTCAAAATGGTAAAGAATTATCATTTA
ATGAAAATAAGCGTTTTGCATATGCTTCCACATTAAAAACTATAAGTAGCGCAATGCTGCTTGAACAAACACCTTACAAC
AAATTAGATAAAAAAATTCACATTAATAAAGATGATATTGTTCCATATTCACCAGTGTTAGAAAAATATATTGGCAAAGA
GATAACTTTAAAAAAGCTTATAGAAGCTACCATGTTATTTAGCGATAACACGGCTAATAATAAAATTATCGATGAATTGG
GAGGATATGGGCAAGTAAAAACGAAACTGATAGATTTAGGCGATACAACGACACATCCATCTAGAAAAGAACCAGACTTA
AATTTTTATTCACCAAAGGATAAACGAGATACAAGTACTCCATTAGCCTATGGTAAAACTTTAAAGAAACTTATAGCTGA
TGGAGATCTTAGCAAAGCAAACAAAGATTTCTTACTTAATCTAATGTTCAAAAATAAAAGTGGCGATACATTAATTAAGG
ATGGTGCACCTTCAAACTTTAAAGTTATGGATAAGAGCGGTCAAGCACTAACATACGGTTCAAGAAACGATGTTGCGTTT
GTTTATCCAGATGGACAAGATAAACCTATAATTCTGGTGATATTTACAAATAAAGATAGAAAAGATGGTAAACCTAATGA
CAAAATAGTAAGTGAGGTTGCTGAAATTGTACTAAAAAATATTAATGAGTAA

>Bla|blaZ_40_DQ269019|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAARCAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTARCAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGGCATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATTG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGAYAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>Bla|NC_010066.5774791|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCGCTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTATTCCAAAAGACTATAAAGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>Bla|X04121.1|gene1|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCCTTCGGTAAGACCCTTAATAAACTTATCGCCAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>Bla|Z_35_AJ302698|betalactams|Class_A_betalactamases|BLAZ
TTAAAATTCCTTCATTACACTCTTGGCGGTTTCACTTATCAACTTATCATTTGGCTTATCACTTTTATTGTCTTTATTCG
TAAAAATGACTAAAACAATAGGTTCAGATTGGCCCTTAGGATAAACAAAAGCAACATCATTTCTAGAAGCATATGTTATT
GCTTGACCACTTTTATCAGCAACCTTACAGTCTTTTGAAACACCGTCTTTAATTAAAGTATCTCCGCTTTTATTATTTAA
CATTAAATCAAGTAAGAATTTTTTGTTTTCTTTGCTTAATTTTCCATTTGCGATAAGTTTATTTAAAGTCTTACCGAAAG
CAGCAGGTGTTGAAGTATCTTTTTTGCTCTTTGGTGAATAGTAATTTAATTCTATCTCATATCTAACTGGATTTGTTACT
TTATCTCCTAGTTCTTTTAGACGTTGTTTAACTTTTTTGATTCCACCAATTTCTTTTATAATTTTATTGTTTGCTGTATT
ATCACTATATGCCATTGAAGCCTCAATAAGTTCTTTTAAAGTGATATCTTTTCCTACATATTTTTCTAAAATAGGAGAAT
AAGCAACTATATCATCTTTGTTAATATGTATTTTTTTATTTAACTTATTATAAGGTACTTGTTCTAACAAAATAGCACTA
TTTATCGCTTTTGAAGTCGAAGCATAGGCAAATCTCTTATCTGAATTAAATTTTACTTCCTTACCACTTTTAGTATCTAA
AGCATAAACACCAATATGAGCATTATATTTTTTTTCTAAATCATTTAACTCTTTGGCATGTGAACTGTTTGAATTACATG
CACTTAAAACTAAAGCAATTGCAATTAAAAATATTAACTTTTTCAA

>Bla|blaZ_34_AP003139|betalactams|Class_A_betalactamases|BLAZ
TTAAAATTCCTTCATTACACTCTTGGCGGTTTCACTTATCAACTTATCATTTGGCTTATCACTTTTATTGTCTTTATTCG
TAAAAATGACTAAAACAATAGGTTCAGATTGGCCCTTAGGATAAACAAAAGCAACATCATTTCTAGAAGCATATGTTATT
GCTTGACCACTTTTATCAGCAACCTTATAGTCTTTTGGAACACCATCTTTAATTAAAGTGTCTCCGTTTTTATTATTAAA
CATTAAATCAAGTAAGAAATTTTTATTTTTTTTGCTTAATTTTCCATTTGCGATAAGTTTATTTAAAGTCTTGCCGAAAG
CAGCAGGCGTTGAAGTATCTTTTTTGCTCTTTGGTGAATAGTAATTTAATTCTATCTCATATCTAACTGGATTTGTTACT
TTATCTCCTAGTTCTTTTAGACGTTGTTTAACTTTTTTGATTCCACCGATTTCTTTTATAATTTTATTGTTTGCTGTATT
ATCACTATATGTCATTGAAGCCTCAATAAGTTCTTTTAAAGTGATATCTTTTCCTACATATTTTTCTAAAATAGGAGAAT
AAGCAACTATATCATCTTTGTTAATATGTACTTTTTTATTTAACTTATTATAAGGTACTTGTTCTAACAAAATAGCACTA
TTTATCGCTTTTGAAGTCGAAGCATAGGCAAATCTCTTATCTGAATTAAATTTTACTTCCTTACCACTTTTAGTATCTAA
AGCATAAACACCAATATGAGCATTATATTTTTTTTCTAAATCATTTAACTCTTTGGCATGTGAACTGTTTGAATTACATG
CACTTAAAACTAAAGCAATTACAATTAAAAATATTAACTTTTTCAA

>Bla|NC_010063.5774822|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>Bla|HE993884.1|gene8|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAATTAATAATTTTAATCATGTTAGCATTGATATTAAGTGCTTGTAATACTAAGCATTCAACTAATAATGATAT
TGAAAAACTCGAAAAAAAATATGGTGCTAACATAGGTATGTATGCGCTTAACACTCAAAACAGTGAAGCATTATCATTTA
ATGAAAATAAACGTTTTGCTTATGCTTCCACATTAAAAGCTATAAGTAGTGCCATGCTACTTGAGCAAACACCTTACAAC
AAATTAGATAAAAAAATTCACATCAACAAAGATGATATCGTTCCATATTCACCAGTGTTAGAGAAATATATCGGCAAAGA
GATAACTATTAAAAAACTTATAGAAGCTACCATGTTATTTAGCGATAACACTGCTAACAATAAAATTATCGATGAATTAG
GAGGGTATGAGCATGTAAAAAATAGACTGACAGATTTAGGAGATACAACTACACATCCATCTAGAAAAGAACCCGACTTA
AATTTTTATTCGCCAAAGGATAAACGAGATACAACTACTCCAATGGCCTATGGTAAATCTTTAAATAAACTTATAGTTGA
TGGAAATCTTAGTAAAGCGAACAAAGATTTATTGCTTGACTTAATGTTGAAAAATAAAAGTGGCGATACATTAATTAAGG
ATGGCGCACCTTCAAACTTTAAAGTTATGGATAAGAGTGGTCAGGCACTAACATACGGTTCAAGAAACGATGTTGCACTT
GTTTATCCAGATGGACAAGATAAACCTATCATTTTAGTTATATTTACAAATAAAGATAAAAAGGATGGTAAACCTAATGA
TAAAATAGTAAGTGAAGTCGCCGAAATTGTATTAAAAAATATGAGTAAATAA