Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

BLACRP

The BLACRP group of genes confer resistance to betalactams through the mechanism, Class A betalactamases.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Class A betalactamases

    Sequences

    Download Sequences

    >>MEG_1272|Drugs|betalactams|Class_A_betalactamases|BLACRP
    atgagactgtcccgccgcctcgttttgctgtcttgcctgctattgccgcaggcaggcttttccgcagccatgcctgccaa
    tcttgccgaccagaaaatagccaggctggagcgcgtttttggcggccagatcggggtgtatgcgctggataccggctcag
    gcgccgccgtgagttaccgcgcggatgagcgcttcccgctgtgcagctcgttcaagggttttctggccgcctccgcgctg
    gcgcatagccagagcaaaccgggctttctggatcaaatcctccattacggcaaggaagagctgatagcctggtcccccat
    ctcggagaagcaccagtccagcggcatgacggtagccggcctgtgcgcggccactgtgcagtacagcgataatgcagccg
    ccaatgtcttgatgaagcagctggatggcccggccggcctgacggccttcatgcgcgccatcggcgacagcaccttccgc
    cttgaccgctgggagccggagttgaacacggccatacccggcgacgcgcgcgatacctccaccccgcgcgccgtggcgga
    aagcctgcaaaaactgacccttggcacggcactggcggcgcatcagcgccagcagctggtggattggctcaaagggaaca
    ctaccggcaaccagcgcattcgcgccgccgtgccggccggctggttggtgggcgacaaaaccggcacttgcggcgtgtac
    ggcacggccaatgattacgcggtgatctggcccactggccgcgcgcccatcgtgatggcggtttatacccgcgcgtccaa
    gaaagacatcaagcacagcgatgccgtcattgccgatgcggccaaggccgcgctggaagcgctaggggtgatgacgcggt
    aa