MEGAResFrom MEG, the Microbial Ecology Group

NMCR

The nmcR gene is a LysR-type transcriptional regulator of the nmcA gene, which encodes a carbapenem-hydrolyzing class A beta-lactamase.

References

Sequences

Download Sequences

>CARD|phgb|Z21956|191-1079|ARO:3003665|NmcR|betalactams|Betalactamase_regulator|NMCR
CTAGGATTTTAATACAAACTCTCTGCTATGCTCGATAATCCATTCCTTGAAAACATTAAGTGCTTCACTATTATGATTAA
CCCGAGATTTCTGCAAAGTAAGCCAATAACCGCCAAGCGTGGCATAAATTTCAAAAGGTTTTGCCACGGATCGCTCATTT
AATTCTTTTTGAAACATATGATAAGGAACTAGTGCTGCATAATCACCTAACTTTACAGCATCTATCATAAGTCTGGTAGA
ATCAAAGATAGGCCCTGTAATAGTCCAAGGGTCGATCCCAGCAGCTTTAAACCAATTATTCCATTCCTCCTTTCGATAGG
AACGCAGTAAGCAAACTTTTTTTAAGTCTGATGGAATGTACAATTTCTTGGATGTTTCCGGGGAACACAATACTGTATGC
GGCGCCTGAAAGAGTAAAATATTTTCCGTATTAATCCAGCCGCCTGTTCCAAATCTAATAGATGCATCAATACCTTCTGC
AGCAAGATTGACAACGTTATTATGCGTTAAAATTCTAATATCAATCCATGGATTTTCATTAAGAAACGCAGTAATCCGAG
GAAGGAGCCATCCTATTGCAAAAGTCCCTACGACAGCAATAGTAAGCACCTCTTTAATCTTACCTTCATGGAATTTATCC
ATCGCAGAACTCATCATCTGCAAAGCTTCTGTAATCGAAGGCAAAAGATGCATGCCTTCGTCTGTCAACTGTAACCCACG
CGGTACTCTTGTAAAAAGAGCCACACCAAGCATTTGTTCAAGTGTTCTGACCTGCTGGCTTACGGCGGCCTGGCTTACAT
GAAGTTCTAGTCCGGCTTTAGTAAAATTTAGATATCTTGCTGAGGCTTCAAAAGCTCGTAATGCATTTAAAGGTAATCTG
GCACGCAT