MEGAResFrom MEG, the Microbial Ecology Group

TETT

The tetT gene encodes a tetracycline ribosomal protection protein.

References

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>Tet|TetT|L42544|478-2433|1956|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETT
ATGAAAATTATTAATATAGGAATATTAGCACATGTTGATGCAGGTAAAACAACTGTTACAGAAGGTTTATTATATAAAAG
TGGGGCGATTAATAAAATTGGAAGAGTTGATAATGCTACAACGACAACGGATTCGATGGAACTTGAAAGAGATAGGGGAA
TAACTATACGGGCGTCTACAGTTTCATTTAATTACAATGATACAAAGGTAAATATCATAGATACACCTGGGCACATGGAT
TTCATAGCCGAAGTTGAGCGAACTCTGAAAGTGTTAGATGGAGCTATTTTAGTAATTTCAGCAAAAGAAGGAATTCAAGT
CCAAACTAAAGTGATTTTTAATACTTTAGTGAAATTAAATATACCAACACTTATATTTGTGAATAAAATAGATCGAAAGG
GAGTATGTTTGGATGAGATATACACTCAAATACAGGAGAAATTAACTTCTAATCTTGCAATAATGCAATCAGTTAAAATA
AAAGATAAAGGTGATTTTGAATTGACAAATGTAAGGGATGATAAAGTAATTCAAAGTCAAATAATAGAGAAGTTACTGGA
TATAAATGATTATCTAGCAGAAAAATATATAAATGGCGATGTCATTGCAGAAAAAGAATATAATGATGTATTTTTGGATG
AGATTAATAACTGCAATCTTTATCCTGTATTTCATGGTTCGGCTTTAAAAAATATTGGAATTGACGAGCTATTATTTGCC
ATTACTAAATATCTTCCTACCAAGAGCTATAATACTGAAGACCTTTTATCAGCGTATGTTTATAAGATTGATAGGGATGA
AAAATCTAGAAAGATGACTTTCTTAAGAGTATTCAGTGGGAATATAAGGACACGTCAAGATGTTTATATAAATGGCACAG
AAGAAACTTTCAAGATAAAAAGTCTGGAATCAATTATGAATGGTGAAATTGTGAAGGTAGGTCAGGTTAATAGTGGGGAT
ATTGCTATTATTTCTAATGCTAATTCTCTGAAGATAGGTGATTATATTGGTAAGAAATATGACGGGATTTTAGATATAAA
GATAGCCCAACCGGCATTGAGAGCATCAATTAAACCTTGTGATTTAAGCAAAAGAAGCAAACTGATAGAAGCACTATTTG
AATTAACTGAAGAAGACCCATTTCTCGATTGTGAAATTAACGGAGATACTGGAGAAATCATATTGAGGCTATTTGGAAAT
ATTCAAATGGAAGTAATAGAATCACTACTTAAAAGCCGATACAAAATAGATGCTAGATTTGGTGAATTGAAAACAATATA
TAAAGAACGACCTAAGAGAAACTCTAAAGCAGTAATCCATATAGAGGTTCCACCAAATCCTTATTGGGCATCTATTGGAC
TGTCAATAGAACCACTACCAATAGGGTCAGGATTATTATATAAGACAGAGGTGTCCTATGGATATTTAAATAATTCATTT
CAAAATGCAGTAAAAGATGCTGTAGAGAAGGCTTGTAAAGAAGGGCTTTATGGATGGGAAGTTACAGACTTAAAGGTAAC
TTTTGACTACGGATTATACTATAGCCCGGTAAGTACCCCCTCTGACTTTAGGAATTTAACACCATATGTATTTTGGGAAG
CTCTTCGAAAAGCAGGAACTGAAATATTAGAACCTTATTTAAAATATACAGTTCAAGTTCCAAATGATTTCTGCGGAAGG
GTTATGAGTGATCTTAGAAAGATGAGGGCTTCTATTGAAGATATAATAGCCAAGGGAGAGGAGACAACTTTAAGTGGAAA
GATACCTGTTGATACATCGAAGTCCTATCAGTCAGAATTACTTTCTTATTCAAATGGAAAGGGTATATTTATTACTGAGC
CTTATGGGTATGATATATATAATGATAAGCCTATAATTAATGATATTGGGAACGACAATAATGATAGCAACAAGGAAGGG
TTAAGATATTTATTTCAAAAACAGGATGAAAATTGA

>Tet|tetT_2_AY660530|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETT
ATGAAAATTATTAATATAGGAATATTAGCACATGTTGATGCAGGTAAAACAACTGTTACAGAAGGTTTATTATATAAAAG
TGGGGCGATTAATAAAATTGGAAGAGTTGATAATGCTACAACGACAACGGATTCGATGGAACTTGAAAGAGATAGGGGAA
TAACTATACGGGCGTCTACAGTTTCATTTAATTACAATGATACAAAGGTAAATATCATAGATACACCTGGGCACATGGAT
TTCATAGCCGAAGTTGAGCGAACTCTGAAAGTGTTAGATGGAGCTATTTTAGTAATTTCAGCAAAAGAAGGAATTCAAGT
CCAAACTAAAGTGATTTTTAATACTTTAGTGAAATTAAATATACCAACACTTATATTTGTGAATAAAATAGATCGAAAGG
GAGTATGTTTGGATGAGATATACACTCAAATACAGGAGAAATTAACTTCTAATCTTGCAATAATGCAATCAGTTAAAATA
AAAGATAAAGGTGATTTTGAATTGACAAATGTAAGGGATGATAAAGTAATTCAAAGTCAAATAATAGAGAAGTTACTGGA
TATAAATGATTATCTAGCAGAAAAATATATAAATGGCGATGTCATTGCAGAAAAAGAATATAATGATGTATTTTTGGATG
AGATTAATAACTGCAATCTTTATCCTGTATTTCATGGTTCGGCTTTAAAAAATATTGGAATTGACGAGCTATTATTTGCC
ATTACTAAATATCTTCCTACCAAGAGCTATAATACTGAAGACCTTTTATCAGCGTATGTTTATAAGATTGATAGGGATGA
AAAATCTAGAAAGATGACTTTCTTAAGAGTATTCAGTGGGAATATAAGGACACGTCAAGATGTTTATATAAATGGCACAG
AAGAAACTTTCAAGATAAAAAGTCTGGAATCAGTTATGAATGGTGAAATTGTGAAGGTAGATCAGGTTAATAGTGGGGAT
ATTGCTATTATTTCTAATGCTAATTCTCTGAAGATAGGTGATTATATTGGTAAGAAATATGACGGGATTTTAGATATAAA
GATAGCCCAACCGGCATTGAGAGCATCAATTAAACCTTGTGATTTAAGCAAAAGAAGCAAACTGATAGAAGCACTATTTG
AATTAACTGAAGAAGACCCATTTCTCGATTGTGAAATTAACGGAGATACTGGAGAAATCATATTGAAGCTATTTGGAAAT
ATTCAAATGGAAGTAATAGAATCACTACTTAAAAGCCGATACAAAATAGATGCTAGATTTTGTGAATTGAAAACAATATA
TAAAGAACGACCTAAGAGAAACTCTAAAGCAGTAATCCATATAGAGGTTCCACCAAATCCTTATTGGGCATCTATTGGAC
TGTCAATAGAACCACTACCAATAGGGTCAGGATTATTATATAAGACAGAGGTGTCCTATGGATATTTAAATAATTCATTT
CAAAATGCAGTAAAAGATGCTGTAGAGAAGGCTTGTAAAGAAGGGCTTTATGGATGGGAAGTTACAGACTTAAAGGTAAC
TTTTGACTACGGATTATACTATAGCCCGGTAAGTACCCCCTCTGACTTTAGGAATTTAACACCATATGTATTTTGGGAAG
CTCTTCGAAAAGCAGGAACTGAAATATTAGAACCTTATTTAAAATATACAGTTCAAGTTCCAAATGATTTCTGCGGAAGG
GTTATGAGTGATCTTAGAAAGATGAGGGCTTCTATTGAAGATATAATAGCCAAGGGAGAGGAGACAACTTTAAGTGGAAA
GATACCTGTTGATACATCGAAGTCCTATCAGTCAGAATTACTTTCTTATTCAAATGGAAAGGGTATATTTATTACTGAGC
CTTATGGGTATGATATATATAATGATAAGCCTATAATTAATGATATTGGGAACGACAATAATGATAGCAACAAGGAAGGG
TTAAGATATTTATTTCAAAAACAGGATGAAAATTGA