MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TETT

The tetT gene encodes a tetracycline ribosomal protection protein.

References

  • http://aac.asm.org/content/47/12/3675

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>>MEG_7202|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETT
ATGAAAATTATTAATATAGGAATATTAGCACATGTTGATGCAGGTAAAACAACTGTTACAGAAGGTTTATTATATAAAAG
TGGGGCGATTAATAAAATTGGAAGAGTTGATAATGCTACAACGACAACGGATTCGATGGAACTTGAAAGAGATAGGGGAA
TAACTATACGGGCGTCTACAGTTTCATTTAATTACAATGATACAAAGGTAAATATCATAGATACACCTGGGCACATGGAT
TTCATAGCCGAAGTTGAGCGAACTCTGAAAGTGTTAGATGGAGCTATTTTAGTAATTTCAGCAAAAGAAGGAATTCAAGT
CCAAACTAAAGTGATTTTTAATACTTTAGTGAAATTAAATATACCAACACTTATATTTGTGAATAAAATAGATCGAAAGG
GAGTATGTTTGGATGAGATATACACTCAAATACAGGAGAAATTAACTTCTAATCTTGCAATAATGCAATCAGTTAAAATA
AAAGATAAAGGTGATTTTGAATTGACAAATGTAAGGGATGATAAAGTAATTCAAAGTCAAATAATAGAGAAGTTACTGGA
TATAAATGATTATCTAGCAGAAAAATATATAAATGGCGATGTCATTGCAGAAAAAGAATATAATGATGTATTTTTGGATG
AGATTAATAACTGCAATCTTTATCCTGTATTTCATGGTTCGGCTTTAAAAAATATTGGAATTGACGAGCTATTATTTGCC
ATTACTAAATATCTTCCTACCAAGAGCTATAATACTGAAGACCTTTTATCAGCGTATGTTTATAAGATTGATAGGGATGA
AAAATCTAGAAAGATGACTTTCTTAAGAGTATTCAGTGGGAATATAAGGACACGTCAAGATGTTTATATAAATGGCACAG
AAGAAACTTTCAAGATAAAAAGTCTGGAATCAATTATGAATGGTGAAATTGTGAAGGTAGGTCAGGTTAATAGTGGGGAT
ATTGCTATTATTTCTAATGCTAATTCTCTGAAGATAGGTGATTATATTGGTAAGAAATATGACGGGATTTTAGATATAAA
GATAGCCCAACCGGCATTGAGAGCATCAATTAAACCTTGTGATTTAAGCAAAAGAAGCAAACTGATAGAAGCACTATTTG
AATTAACTGAAGAAGACCCATTTCTCGATTGTGAAATTAACGGAGATACTGGAGAAATCATATTGAGGCTATTTGGAAAT
ATTCAAATGGAAGTAATAGAATCACTACTTAAAAGCCGATACAAAATAGATGCTAGATTTGGTGAATTGAAAACAATATA
TAAAGAACGACCTAAGAGAAACTCTAAAGCAGTAATCCATATAGAGGTTCCACCAAATCCTTATTGGGCATCTATTGGAC
TGTCAATAGAACCACTACCAATAGGGTCAGGATTATTATATAAGACAGAGGTGTCCTATGGATATTTAAATAATTCATTT
CAAAATGCAGTAAAAGATGCTGTAGAGAAGGCTTGTAAAGAAGGGCTTTATGGATGGGAAGTTACAGACTTAAAGGTAAC
TTTTGACTACGGATTATACTATAGCCCGGTAAGTACCCCCTCTGACTTTAGGAATTTAACACCATATGTATTTTGGGAAG
CTCTTCGAAAAGCAGGAACTGAAATATTAGAACCTTATTTAAAATATACAGTTCAAGTTCCAAATGATTTCTGCGGAAGG
GTTATGAGTGATCTTAGAAAGATGAGGGCTTCTATTGAAGATATAATAGCCAAGGGAGAGGAGACAACTTTAAGTGGAAA
GATACCTGTTGATACATCGAAGTCCTATCAGTCAGAATTACTTTCTTATTCAAATGGAAAGGGTATATTTATTACTGAGC
CTTATGGGTATGATATATATAATGATAAGCCTATAATTAATGATATTGGGAACGACAATAATGATAGCAACAAGGAAGGG
TTAAGATATTTATTTCAAAAACAGGATGAAAATTGA

>>MEG_7203|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETT
ATGAAAATTATTAATATAGGAATATTAGCACATGTTGATGCAGGTAAAACAACTGTTACAGAAGGTTTATTATATAAAAG
TGGGGCGATTAATAAAATTGGAAGAGTTGATAATGCTACAACGACAACGGATTCGATGGAACTTGAAAGAGATAGGGGAA
TAACTATACGGGCGTCTACAGTTTCATTTAATTACAATGATACAAAGGTAAATATCATAGATACACCTGGGCACATGGAT
TTCATAGCCGAAGTTGAGCGAACTCTGAAAGTGTTAGATGGAGCTATTTTAGTAATTTCAGCAAAAGAAGGAATTCAAGT
CCAAACTAAAGTGATTTTTAATACTTTAGTGAAATTAAATATACCAACACTTATATTTGTGAATAAAATAGATCGAAAGG
GAGTATGTTTGGATGAGATATACACTCAAATACAGGAGAAATTAACTTCTAATCTTGCAATAATGCAATCAGTTAAAATA
AAAGATAAAGGTGATTTTGAATTGACAAATGTAAGGGATGATAAAGTAATTCAAAGTCAAATAATAGAGAAGTTACTGGA
TATAAATGATTATCTAGCAGAAAAATATATAAATGGCGATGTCATTGCAGAAAAAGAATATAATGATGTATTTTTGGATG
AGATTAATAACTGCAATCTTTATCCTGTATTTCATGGTTCGGCTTTAAAAAATATTGGAATTGACGAGCTATTATTTGCC
ATTACTAAATATCTTCCTACCAAGAGCTATAATACTGAAGACCTTTTATCAGCGTATGTTTATAAGATTGATAGGGATGA
AAAATCTAGAAAGATGACTTTCTTAAGAGTATTCAGTGGGAATATAAGGACACGTCAAGATGTTTATATAAATGGCACAG
AAGAAACTTTCAAGATAAAAAGTCTGGAATCAGTTATGAATGGTGAAATTGTGAAGGTAGATCAGGTTAATAGTGGGGAT
ATTGCTATTATTTCTAATGCTAATTCTCTGAAGATAGGTGATTATATTGGTAAGAAATATGACGGGATTTTAGATATAAA
GATAGCCCAACCGGCATTGAGAGCATCAATTAAACCTTGTGATTTAAGCAAAAGAAGCAAACTGATAGAAGCACTATTTG
AATTAACTGAAGAAGACCCATTTCTCGATTGTGAAATTAACGGAGATACTGGAGAAATCATATTGAAGCTATTTGGAAAT
ATTCAAATGGAAGTAATAGAATCACTACTTAAAAGCCGATACAAAATAGATGCTAGATTTTGTGAATTGAAAACAATATA
TAAAGAACGACCTAAGAGAAACTCTAAAGCAGTAATCCATATAGAGGTTCCACCAAATCCTTATTGGGCATCTATTGGAC
TGTCAATAGAACCACTACCAATAGGGTCAGGATTATTATATAAGACAGAGGTGTCCTATGGATATTTAAATAATTCATTT
CAAAATGCAGTAAAAGATGCTGTAGAGAAGGCTTGTAAAGAAGGGCTTTATGGATGGGAAGTTACAGACTTAAAGGTAAC
TTTTGACTACGGATTATACTATAGCCCGGTAAGTACCCCCTCTGACTTTAGGAATTTAACACCATATGTATTTTGGGAAG
CTCTTCGAAAAGCAGGAACTGAAATATTAGAACCTTATTTAAAATATACAGTTCAAGTTCCAAATGATTTCTGCGGAAGG
GTTATGAGTGATCTTAGAAAGATGAGGGCTTCTATTGAAGATATAATAGCCAAGGGAGAGGAGACAACTTTAAGTGGAAA
GATACCTGTTGATACATCGAAGTCCTATCAGTCAGAATTACTTTCTTATTCAAATGGAAAGGGTATATTTATTACTGAGC
CTTATGGGTATGATATATATAATGATAAGCCTATAATTAATGATATTGGGAACGACAATAATGATAGCAACAAGGAAGGG
TTAAGATATTTATTTCAAAAACAGGATGAAAATTGA