MEGAResFrom MEG, the Microbial Ecology Group

TETL

The tetL gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|tetL_1_HM235948|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETL
GTGAATACGTCTTATTCACAATCAAATTTACGACACAACCAAATTTTAATTTGGCTTTGCGTTCTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAATCACCGGCGAGTACAAGCTGGG
TGAACACAGCCTTTATGTTAACCTTTTCTATTGGAACAGCTCTATATGGAAAGCTATCTGATCAGCTAGGCATTAAAAGG
TTACTCCTATTTGGGATTATAATAAATTGCTTCGGATCGGTAATTGGGTTTGTTGGACATTCTTTTTTTCCCATACTTAT
TCTGGCTCGATTTATTCAAGGAGCTGGTGCAGCTGCATTTCCAGCACTCGTGATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCGTTTGGTCTTATTGGCTCCATAGTAGCTATGGGAGAAGGTATCGGTCCAGCTATTGGTGGA
ATGATAGCTCATTTTATCCATTGGTCTTATCTTCTGCTCATTCCAATGATGACAATTATCACTGTTCCGTTCCTTATTAA
ATTGTTGAAAAAAGAAGTAAGGATAAAAGGTCATTTTGATATTGTAGGAATTATACTAATGTCAGTGGGCATTGTATTTT
TTATGCTGTTTACAACATCTTATAACATTTCTTTTCTGATCATCAGTATTCTGTCATTCCTGATATTTGTAAAACATATT
AGGAAAGTAACAGAACCTTTTGTTGAACCTGCACTGGGGAAAAATATTTCTTTTATAATTGGTGTCCTTTGTGGAGGACT
TATATTTGGTACAGTAGCAGGGTTTATCTATATGGTTCCTTACATGATGAAAGATGTACATCAACTAAGTACTGCTGCAA
TTGGCAGTGTGATTATTTTCCCTGGAACAATGAGCGTTATTATCTTCGGTTACATTGGTGGATTACTTGTTGATAGAAAA
GGTCCATTGTACGTGTTAACCATTGGAGTTACATTTCTTTCCGTTAGCTTTTTAATTGCTGCCTTTTTTTTAGAAGTAAC
ACCATGGTTACTGACAATTATATTAGTTTTTGTTTTTGGTGGGCTGTCATTCACCAAAACAGTTATATCTACAATTGTTT
CAAGTAGTTTGAAACAAAAGGAAGCTGGTGCCGGAATGAGTTTGCTTAATTTTACCAGTTTTTTATCAGAGGGAATAGGT
ATTGCAATTGTTGGTGGTTTATTATCTGTACGCTTACTGAATCAGAAGTTGCTACCTATGGACCTTGATCAATCCACTTA
TTTGTATAGTAATATGCTATTCCTTTTTACAGGAGTCGTTGTTACTAGTTGGCTGATCACCTTGAATGTATATAAACGAA
GACAAATTCAATTTAAAAGTTGA

>Tet|tetL_7_D12567|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETL
GTGAATACGTCTTATTCACAGTCAACTTTACGGCACAATCAAGTTTTGATTTGGCTTTGTGTTCTATCATTTTTCAGCGT
ATTAAATGAAATGGTTCTGAACGTCTCATTACCTGATATTGCCAACGAGTTTAATAAACTGCCAGCAAGTGCAAACTGGG
TGAATACAGCCTTTATGTTAACCTTCTCCATTGGAACAGCTCTATATGGAAAGCTATCAGACCAGCTGGGCATCAAAAAT
CTGCTTCTATTTGGGATTATGGTAAATGGCTTAGGGTCGATCATTGGATTTGTTGGACACTCTTTCTTTCCTATTCTCAT
TCTAGCCCGATTTATTCAAGGAATTGGTGCAGCCGCATTCCCAGCTCTTGTGATGGTTGTCGTTGCGCGCTATATTCCAA
AAGAGAACAGGGGGAAAGCATTTGGCCTGATCGGGTCCCTGGTAGCAATGGGAGAAGGTGTTGGGCCAGCTATTGGCGGA
ATGGTTGCTCATTATATCCATTGGTCGTATTTGCTGCTTATTCCAACTGCAACAATTATCACCGTTCCATTCCTTATAAA
ATTGTTGAAAAAGGAAGAGAGAATAAGAGGACACATTGATATGGCAGGGATTATATTGATGTCTGCAGGTATCGTATTTT
TTATGCTGTTTACAACATCTTATAGATTTTCTTTTCTGATCATCAGTATCCTTGCTTTCTTCATATTTGTGCAACACATT
AGGAAAGCTCAGGACCCTTTTGTTGACCCTGAATTAGGGAAAAACGTCTTTTTTGTGATTGGAACCCTTTGCGGAGGACT
AATATTTGGTACAGTAGCAGGATTTGTCTCTATGGTTCCTTACATGATGAAAGATGTTCACCATTTAAGTACTGCAGCAA
TTGGAAGCGGCATTATTTTCCCCGGAACAATGAGTGTCATCATCTTTGGTTACATTGGGGGATTGCTTGTTGATCGGAAA
GGTTCCTTGTATGTACTAACTATTGGAAGTGCCTTGCTTTCTTCCGGCTTTTTAATCGCTGCCTTTTTTATAGATGCAGC
ACCATGGATCATGACAATTATAGTAATTTTTGTTTTTGGGGGGCTATCTTTCACAAAAACAGTTATATCTACAGTTGTGT
CTAGCAGTTTGAAAGAAAAGGAAGCGGGCGCTGGAATGAGTTTGCTTAATTTCACGAGCTTTTTATCAGAGGGAACGGGT
ATTGCGATTGTAGGCGGTTTATTATCTATCGGCTTCCTAGACCATAGGCTGCTGCCTATTGACGTTGATCACTCTACCTA
TTTGTATAGCAATATGCTCATACTTTTTGCAGGAACCATTGTTATTTGTTGGCTAGTAATCTTGAATGTATATAAACGTT
CGCGGAGGCATCGCTAA

>Tet|tetL_8_X60828|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETL
GTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAATTTGGCTTTGCATTTTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAACCACCTGCGAGTACAAACTGGG
TGAACACAGCCTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGGCATCAAAAGG
TTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGGTAATTGGGTTTGTTGGCCATTCTTTCTTTTCCTTACTTAT
TATGGCTCGTTTTATTCAAGGGGCTGGTGCAGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGCGATTGGTGGA
ATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATCATAACAATTATCACTGTTCCGTTTCTTATGAA
ATTATTAAAGAAAGAAGTAAGGATAAAAGGTCATTTTGGATCTAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTT
TTATGTTGTTTACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGTAAAACATATC
AGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACCTTTTATGATTGGAGTTCTTTGTGGGGGAAT
TATATTTGGAACAGTAGCAGGGTTTGTCTCTATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAA
TCGGAAGTGTAATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGTTGATAGAAGA
GTGCCTTTATATGCGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTTTTTAACTGCTTCCTTTCTTTTAGAAACAAC
ATCATGGTTCATGACAATTATTATCGTATTTGTTTTAGGTGGGCTTTCGTTCACCAAAACAGTTATATCAACAATTGTTT
CAAGTAGCTTGAAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCCTTTTATCAGAGGGAACAGGT
ATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCCACGGTTGTTACCTATGGAAGTTGATCAGTCAACTTA
TCTGTATAGTAATTTGTTATTACTTTTTTCAGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATCTATATAAACATT
CTCAAAGGGATTTCTAA

>Tet|tetL_6_X08034|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETL
GTGAATACGTCTTATTCACAGTCAACTTTACGGCACAATCAAGTTTTGATTTGGCTTTGTGTTCTATCATTTTTCAGCGT
ATTAAATGAAATGGTTCTGAACGTCTCATTACCTGATATTGCCAACGAGTTTAATAAACTGCCAGCAAGTGCAAACTGGG
TGAATACAGCCTTTATGTTAACCTTCTCCATTGGAACAGCTCTATATGGAAAGCTATCAGACCAGCTGGGCATCAAAAAT
CTGCTTCTATTTGGGATTATGGTAAATGGCTTAGGGTCGATCATTGGATTTGTTGGACACTCTTTCTTTCCTATTCTCAT
TCTAGCCCGATTTATTCAAGGAATTGGTGCAGCCGCATTCCCAGCTCTTGTGATGGTTGTCGTTGCGCGCTATATTCCAA
AAGAGAACAGGGGGAAAGCATTTGGCCTGATCGGGTCCCTGGTAGCAATGGGAGAAGGTGTTGGGCCAGCTATTGGCGGA
ATGGTTGCTCATTATATCCATTGGTCGTATTTGCTGCTTATTCCAACTGCAACAATTATCACCGTTCCATTCCTTATAAA
ATTGTTGAAAAAGGAAGAGAGAATAAGAGGACACATTGATATGGCAGGGATTATATTGATGTCTGCAGGTATCGTATTTT
TTATGCTGTTTACAACATCTTATAGATTTTCTTTTCTGATCATCAGTATCCTTGCTTTCTTCATATTTGTGCAACACATT
AGGAAAGCTCAGGACCCTTTTGTTGACCCTGAATTAGGGAAAAACGTCTTTTTTGTGATTGGAACCCTTTGCGGAGGACT
AATATTTGGTACAGTAGCAGGATTTGTCTCTATGGTTCCTTACATGATGAAAGATGTTCACCATTTAAGTACTGCAGCAA
TTGGAAGCGGCATTATTTTCCCCGGAACAATGAGTGTCATCATCTTTGGTTACATTGGGGGATTGCTTGTTGATCGGAAA
GGTTCCTTGTATGTACTAACTATTGGAAGTGCATTGCTTTCTTCCGGCTTTTTAATCGCTGCCTTTTTTATAGATGCAGC
ACCATGGATCATGACAATTATAGTAATTTTTGTTTTTGGGGGGCTATCTTTCACAAAAACAGTTATATCTACAGTTGTGT
CTAGCAGTTTGAAAGAAAAGGAAGCGGGCGCTGGAATGAGTTTGCTTAATTTCACGAGCTTTTTATCAGAGGGAACGGGT
ATTGCGATTGTAGGCGGTTTATTATCTATCGGCTTCCTAGATCATAGGCTGCTGCCTATTGACGTTGATCACTCTACCTA
TTTGTATAGCAATATGCTCATACTTTTTGCAGGAATCATTGTTATTTGTTGGCTAGTAATCTTGAATGTATATAAACGTT
CGCGGAGACATGGCTAA

>Tet|tetL_9_AY081910|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETL
GTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAATTTGGCTTTGCATTTTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAACCACCTGCGAGTACAAACTGGG
TGAACACAGCCTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGGCATCAAAAGG
TTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGTTAATTGGGTTTGTTGGCCATTCTTTCTTTTCCTTACTTAT
TATGGCTCGTTTTATTCAAGGGGCTGGTGCAGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGCGATTGGTGGA
ATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATGATAACAATTATCACTGTTCCGTTTCTTATGAA
ATTATTAAAGAAAGAAGTAAGGATAAAAGGTCATTTTGATATCAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTT
TTATGTTGTTTACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGTAAAACATATC
AGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACCTTTTATGATTGGAGTTCTTTGTGGGGGAAT
TATATTTGGAACAGTAGCAGGGTTTGTCTCTATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAA
TCGGAAGTGTAATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGTTGATAGAAGA
GGTCCTTTATACGTGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTTTTTAACTGCTTCCTTTCTTTTAGAAACAAC
ATCATGGTTCATGACAATTATAATCGTATTTGTTTTAGGTGGGCTTTCGTTCACCAAAACAGTTATATCAACAATTGTTT
CAAGTAGCTTGAAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCTTTTTATCAGAGGGAACAGGT
ATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCAAAGGTTGTTACCTATGGAAGTTGATCAGTCAACTTA
TCTGTATAGTAATTTGTTATTACTTTTTTCAGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATGTATATAAACATT
CTCAAAGGGATTTCTAA

>Tet|tetL_4_M11036|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETL
GTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAATTTGGCTTTGCATTTTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAACCACCTGCGAGTACAAACTGGG
TGAACACAGCCTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGGCATCAAAAGG
TTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGGTAATTGGGTTTGTTGGCCATTCTTTCTTTTCCTTACTTAT
TATGGCTCGTTTTATTCAAGGGGCTGGTGCAGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGCGATTGGTGGA
ATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATGATAACAATTATCACTGTTCCGTTTCTTATGAA
ATTATTAAAGAAAGAAGTAAGGATAAAAGGTCATTTTGATATCAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTT
TTATGTTGTTTACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGTAAAACATATC
AGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACCTTTTATGATTGGAGTTCTTTGTGGGGGAAT
TATATTTGGAACAGTAGCAGGGTTTGTCTCTATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAA
TCGGAAGTGTAATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGTTGATAGAAGA
GGTCCTTTATACGTGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTTTTTAACTGCTTCCTTTCTTTTAGAAACAAC
ATCATGGTTCATGACAATTATAATCGTATTTGTTTTAGGTGGGCTTCTGTTCACCAAAACAGTTATATCAACAATTGTTT
CAAGTAGCTTGAAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCTTTTTATCAGAGGGAACAGGT
ATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCAAAGGTTATTACCTATGGAAGTTGATCAGTCAACTTA
TCTGTATAGTAATTTGTTATTACTTTTTTCAGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATGTATATAAACATT
CTCAAAGGGATTTCTAA

>Tet|TetL|FN435329|1-1377|1377|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETL
GTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAATTTGGCTTTGCATTTTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAACCACCTGCGAGTACAAACTGGG
TGAACACAGCCTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGGCATCAAAAGG
TTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGGTAATTGGGTTTGTTGGCCATTCTTTCTTTTCCTTACTTAT
TATGGCTCGTTTTATTCAAGGGGCTGGTGCAGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGCGATTGGTGGA
ATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATGATAACAATTATCACTGTTCCGTTTCTTATGAA
ATTATTAAAGAAAGAAGTAAGGATAAAAGGTCATTTTGATATCAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTT
TTATGTTGTTTACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGTAAAACATATC
AGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACCTTTTATGATTGGAGTTCTTTGTGGGGGAAT
TATATTTGGAACAGTAGCAGGGTTTGTCTCTATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAA
TCGGAAGTGTAATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGTTGATAGAAGA
GGTCCTTTATACGTGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTTTTTAACTGCTTCCTTTCTTTTAGAAACAAC
ATCATGGTTCATGACAATTATAATCGTATTTGTTTTAGGTGGGCTTTCGTTCACCAAAACAGTTATATCAACAATTGTTT
CAAGTAGCTTGAAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCTTTTTATCAGAGGGAACAGGT
ATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCAAAGGTTGTTACCTATGGAAGTTGATCAGTCAACTTA
TCTGTATAGTAATTTGTTATTACTTTTTTCAGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATGTATATAAACATT
CTCAAAGGGATTTCTAA

>Tet|tetL_5_D00006|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETL
GTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAATTTGGCTTTGCATTTTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAACCACCTGCGAGTACAAACTGGG
TGAACACAGCCTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGGCATCAAAAGG
TTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGGTAATTGGGTTTGTTGGCCATTCTTTCTTTTCCTTACTTAT
TATGGCTCGTTTTATTCAAGGGGCTGGTGCAGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGCGATTGGTGGA
ATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATGATAACAATTATCACTGTTCCGTTTCTTATGAA
ATTATTAAAGAAAGAAGTAAGGATAAAAGGTCATTTTGATATCAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTT
TTATGTTGTTTACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGTAAAACATATC
AGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACCTTTTATGATTGGAGTTCTTTGTGGGGGAAT
TATATTTGGAACAGTAGCAGGGTTTGTCTCTATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAA
TCGGAAGTGTAATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGTTGATAGAAGA
GGTCCTTTATACGTGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTTTTTAACTGCTTCCTTTCTTTTAGAAACAAC
ATCATGGTTCATGACAATTATAATCGTATTTGTTTTAGGTGGGCTTTCGTTCACCAAAACAGTTATATCAACAATTGTTT
CAAGTAGCTTGAAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCTTTTTATCAGAGGGAACAGGT
ATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCAAAGGTTATTACCTATGGAAGTTGATCAGTCAACTTA
TCTGTATAGTAATTTGTTATTACTTTTTTCAGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATGTATATAAACATT
CTCAAAGGGATTTCTAA