MEGAResFrom MEG, the Microbial Ecology Group

TETH

The tetH gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|tetH_4_U00792|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGTTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTAAAGCTGTTATTTCAACCCCT
TAA

>Tet|tetH_3_Y15510|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTAAAGCTGTTATTTCAACCCCT
TAA

>1482|HF953351.1|HF953351|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTTAA

>Tet|tetH_1_Y16103|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGGGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTAAAGCTGTTATTTCAACCCCT
TAA

>Tet|tetH_2_AJ245947|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAAGCGATTAA