MEGAResFrom MEG, the Microbial Ecology Group

TETE

The tetE gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|TetE|DQ366299|36-1253|1218|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETE
ATGAACCGCACTGTGATGATGGCACTGGTCATCATTTTTTTAGATGCCATAGGGATTGGCATAATTATGCCTGTCTTACC
GGCGTTATTACGGGAGTTTGTTGGAAAGGCTAATGTTGCGGAGAACTACGGTGTTTTATTGGCGCTGTATGCAATGATGC
AAGTGATTTTTGCCCCTCTTCTCGGCCGCTGGTCAGATCGCATAGGTCGTCGCCCTGTATTATTACTTTCACTTTTAGGT
GCAACACTGGACTACGCATTAATGGCAACAGCCAGCGTAGTGTGGGTGTTGTATCTGGGACGCTTAATTGCTGGTATTAC
CGGTGCGACTGGAGCTGTTGCAGCCTCAACAATTGCCGATGTCACACCTGAGGAATCCAGGACACATTGGTTTGGTATGA
TGGGTGCCTGTTTTGGTGGCGGTATGATTGCTGGACCAGTCATTGGTGGTTTTGCAGGTCAACTTTCGGTACAGGCACCG
TTTATGTTCGCTGCTGCCATTAACGGGCTGGCATTTCTGGTCTCCCTATTCATTTTACATGAGACCCATAATGCTAATCA
GGTTAGTGACGAGATAAAGAATGAAACAATCAATGAAACCACATCCTCCATACGCGAGATGATCTCCCCATTATCGGGAT
TGCTAGTTGTCTTTTTCATCATTCAATTGATTGGCCAAATCCCTGCAACATTATGGGTTTTATTCGGAGAAGAGCGCTTC
GCATGGGATGGCGTAATGGTCGGTGTTTCATTGGCTGTGTTTGGGCTTACACACGCTCTGTTTCAAGGACTTGCTGCTGG
TTTTATCGCTAAACATTTGGGAGAACAGAGAGCTATCGTGGTTGGCATCTTGGCTGATGGCTGTGGCCTACTTTTATTGG
CAGTCATTACGCAAAGCTGGATGGTTTGGCCAGTTGTGCTGTTACTCGCTTGTGGTGGCATAACTCTTCCCGCTTTGCAG
GGAATTATATCTGTTCGTGTCGGTCAGGTAGCACAGGGACAATTGCAAGGGTTGCTGACCAGTTTGACACACCTCACGGG
TGTAATCGGTCCACTTATTTTTGCATTTTTGTATAGTGCAACCCACGAATCTTGGAATGGTTGGGTGTGGATAGTTGGAT
GCGGATTGTATGTAGTTGCACTGACTATACTGAGGTTTTTCTATCCCGGCAGGGCAGTCCACCCGAAAAATCAGAGCAAT
TCACAGCCATTTCTTTAA

>Tet|tetE_2_EF471995|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETE
AACCTTTTAATGCTATGGGGGATTGGCATAATTATGCCTGTCTTGCCGGCGTTATTACGGGAGTTTGTTGGAAAGGCTAA
TGTTGCAGAGAACTACGGTGTTTTATTGGCGCTGTATGCAATGATGCAAGTGATTTTTGCCCCTCTTCTCGGCCGCTGGT
CAGATCGCATAGGTCGTCGCCCTGTATTGTTACTTTCACTTTTAGGTGCAACACTGGACTACGCATTAATGGCAACAGCC
AGCGTAGTGTGGGTGTTGTATTTGGGACGCTTAATTGCTGGTATTACCGGTGCGACTGGAGCTGTTGCAGCCTCAACAAT
TGCCGATGTCACACCTGAGGAATCCAGGACACATTGGTTTGGTATGATGGGTGCCTGTTTTGGTGGCGGTATGATTGCTG
GACCAGTCATTGGTGGTTTTGCCGGTCAACTTTCGGTACAGGCACCGTTTATGTTCGCTGCTGCTATTAACGGGCTGGCA
TTTCTGGTCTCCCTATTCATTTTACATGAGACCCATAATGCTAATCAGGTTAGTGACGAGTTAAAGAATGAAACAATCAA
TGAAACCACATCCTCCATACGCGAGATGATCTCCCCATTATCGGGATTGTTAGTTGTCTTTTTCATCATTCAATTGATTG
GCCAAATCCCCGCAACATTATGGGTTTTATTCGGAGAAGAGCGCTTCGCATGGGATGGCGTAATGGTCGGTGTTTCATTG
GCTGTGTTCGGGCTGACACACGCACTGTTTCAAGGACTTGCTGCTGGTTTTATCGCTAAACATTTGGGAGAACGGAAAGC
TATAGCGGTTGGCATTTTGGCTGACGGTTGTGGCCTATTTTTATTGGCGGTCATTACACAAAGCTGGATGGTTTGGCCGG
TTTTGCTGTTACTAGCTTGTGGTGGCATCACACTTCCCGCCTTGCAGGGAATTATATCTGTTCGTGTCGGTCAGGTAGCA
CAGGGACAATTACAAGGGGTGCTGACCAGTTTGACCACCTGACAGGTGTAATCGGGCCACTTGTTTTTGCATTTTTGTAT
AGTGCACCCCCCAAACGTGAAATGAATGGGTATGAATATTGGCCGCCGATATATGTAGTTGCATTGATATACTGAAGTTT
TTCCTCCCGGTAGGGTACCCCCCCATAATAAACGCGGTTTTCCCCCAAAA

>Tet|tetE_1_Y19116|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETE
GTGATGATGGCACTGGTCATCATTTTTTTAGATGCTATGGGGATTGGCATAATTATGCCTGTCTTGCCGGCGTTATTACG
GGAGTTTGTTGGAAAGGCTAATGTTGCAGAGAACTACGGTGTTTTATTGGCGCTGTATGCAATGATGCAAGTGATTTTTG
CCCCTCTTCTCGGCCGCTGGTCAGATCGCATAGGTCGTCGCCCTGTATTGTTACTTTCACTTTTAGGTGCAACACTGGAC
TACGCATTAATGGCAACAGCCAGCGTAGTGTGGGTGTTGTATTTGGGACGCTTAATTGCTGGTATTACCGGTGCGACTGG
AGCTGTTGCAGCCTCAACAATTGCCGATGTCACACCTGAGGAATCCAGGACACATTGGTTTGGTATGATGGGTGCCTGTT
TTGGTGGCGGTATGATTGCTGGACCAGTCATTGGTGGTTTTGCCGGTCAACTTTCGGTACAGGCACCGTTTATGTTCGCT
GCTGCTATTAACGGGCTGGCATTTCTGGTCTCCCTATTCATTTTACATGAGACCCATAATGCTAATCAGGTTAGTGACGA
GTTAAAGAATGAAACAATCAATGAAACCACATCCTCCATACGCGAGATGATCTCCCCATTATCGGGATTGTTAGTTGTCT
TTTTCATCATTCAATTGATTGGCCAAATCCCCGCAACATTATGGGTTTTATTCGGAGAAGAGCGCTTCGCATGGGATGGC
GTAATGGTCGGTGTTTCATTGGCTGTGTTCGGGCTGACACACGCACTGTTTCAAGGACTTGCTGCTGGTTTTATCGCTAA
ACATTTGGGAGAACGGAAAGCTATAGCGGTTGGCATTTTGGCTGACGGTTGTGGCCTATTTTTATTGGCGGTCTTTACAC
AAAGCTGGATGGTTTGCCCGGTTTTGCTGTTACTAGCTTGTGGTGGCATCACACTTCCCGCCTTGCAGGGAATTATATCT
GTTCGTGTCGGTCAGGTAGCACAGGGACAATTACAAGGGGTGCTGACCAGTTTGACCCACCTGACAGCTGTAATCGGTCC
ACTTGTTTTTGCATTTTTGTATAGTGCAACCCGCGAAACGTGGAATGGATGGGTATGGATAATTGGCTGCGGATTATATG
TAGTTGCATTGATTATACTGAGGTTTTTCCATCCAGGTAGGGTAATCCACCCGATAAATAAGAGCGATGTACAGCA

>Tet|tetE_3_L06940|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETE
ATGAACCGCACTGTGATGATGGCACTGGTCATCATTTTTTTAGATGCTATGGGGATTGGCATAATTATGCCTGTCTTGCC
GGCGTTATTACGGGAGTTTGTTGGAAAGGCTAATGTTGCAGAGAACTACGGTGTTTTATTGGCGCTGTATGCAATGATGC
AAGTGATTTTTGCCCCTCTTCTCGGCCGCTGGTCAGATCGCATAGGTCGTCGCCCTGTATTGTTACTTTCACTTTTAGGT
GCAACACTGGACTACGCATTAATGGCAACAGCCAGCGTAGTGTGGGTGTTGTATTTGGGACGCTTAATTGCTGGTATTAC
CGGTGCGACTGGAGCTGTTGCAGCCTCAACAATTGCCGATGTCACACCTGAGGAATCCAGGACACATTGGTTTGGTATGA
TGGGTGCCTGTTTTGGTGGCGGTATGATTGCTGGACCAGTCATTGGTGGTTTTGCCGGTCAACTTTCGGTACAGGCACCG
TTTATGTTCGCTGCTGCTATTAACGGGCTGGCATTTCTGGTCTCCCTATTCATTTTACATGAGACCCATAATGCTAATCA
GGTTAGTGACGAGTTAAAGAATGAAACAATCAATGAAACCACATCCTCCATACGCGAGATGATCTCCCCATTATCGGGAT
TGTTAGTTGTCTTTTTCATCATTCAATTGATTGGCCAAATCCCCGCAACATTATGGGTTTTATTCGGAGAAGAGCGCTTC
GCATGGGATGGCGTAATGGTCGGTGTTTCATTGGCTGTGTTCGGGCTGACACACGCACTGTTTCAAGGACTTGCTGCTGG
TTTTATCGCTAAACATTTGGGAGAACGGAAAGCTATAGCGGTTGGCATTTTGGCTGACGGTTGTGGCCTATTTTTATTGG
CGGTCATTACACAAAGCTGGATGGTTTGGCCGGTTTTGCTGTTACTAGCTTGTGGTGGCATCACACTTCCCGCCTTGCAG
GGAATTATATCTGTTCGTGTCGGTCAGGTAGCACAGGGACAATTACAAGGGGTGCTGACCAGTTTGACCCACCTGACAGC
TGTAATCGGTCCACTTGTTTTTGCATTTTTGTATAGTGCAACCCGCGAAACGTGGAATGGATGGGTATGGATAATTGGCT
GCGGATTATATGTAGTTGCATTGATTATACTGAGGTTTTTCCATCCAGGTAGGGTAATCCACCCGATAAATAAGAGCGAT
GTACAGCAGAGAATTTGA