MEGAResFrom MEG, the Microbial Ecology Group

TETE

The tetE gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_7071|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETE
atgaaccgcactgtgatgatggcactggtcatcatttttttagatgccatagggattggcataattatgcctgtcttacc
ggcgttattacgggagtttgttggaaaggctaatgttgcggagaactacggtgttttattggcgctgtatgcaatgatgc
aagtgatttttgcccctcttctcggccgctggtcagatcgcataggtcgtcgccctgtattattactttcacttttaggt
gcaacactggactacgcattaatggcaacagccagcgtagtgtgggtgttgtatctgggacgcttaattgctggtattac
cggtgcgactgtagctgttgcagcctcaacaattgccgatgtcacacctgaggaatccaggacacattggtttggtatga
tgagtgcctgttttggtggcggtatgattgctggaccagtcattggtggttttgcaggtcaactttcggtacaggcaccg
tttatgttcgctgctgccattaacgggctggcatttctggtctccctattcattttacatgagacccataatgctaatca
ggttagtgacgagataaagaatgaaacaatcaatgaaaccacatcctccatacgcgagatgatctccccattatcgggat
tgctagttgtctttttcatcattcaattgattggccaaatccctgcaacattatgggttttattcggagaagagcgcttc
gcatgggatggcgtaatggtcggtgtttcattggctgtgtttgggcttacacacgctctgtttcaaggacttgctgctgg
ttttatcgctaaacatttgggagaacagagagctatcgtggttggcatcttggctgatggctgtggcctacttttattgg
cagtcattacgcaaagctggatggtttggccagttgtgctgttactcgcttgtggtggcataactcttcccgctttgcag
ggaattatatctgttcgtgtcggtcaggtagcacagggacaattgcaagggttgctgaccagtttgacacacctcacggg
tgtaatcggtccacttatttttgcatttttgtatagtgcaacccacgaatcttggaatggttgggtgtggatagttggat
gcggattgtatgtagttgcactgactatactgaggtttttctatcccggcagggcagtccacccgaaaaatcagagcaat
tcacagccatttctttaa

>>MEG_7072|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETE
ATGAACCGCACTGTGATGATGGCACTGGTCATCATTTTTTTAGATGCCATAGGGATTGGCATAATTATGCCTGTCTTACC
GGCGTTATTACGGGAGTTTGTTGGAAAGGCTAATGTTGCGGAGAACTACGGTGTTTTATTGGCGCTGTATGCAATGATGC
AAGTGATTTTTGCCCCTCTTCTCGGCCGCTGGTCAGATCGCATAGGTCGTCGCCCTGTATTATTACTTTCACTTTTAGGT
GCAACACTGGACTACGCATTAATGGCAACAGCCAGCGTAGTGTGGGTGTTGTATCTGGGACGCTTAATTGCTGGTATTAC
CGGTGCGACTGGAGCTGTTGCAGCCTCAACAATTGCCGATGTCACACCTGAGGAATCCAGGACACATTGGTTTGGTATGA
TGGGTGCCTGTTTTGGTGGCGGTATGATTGCTGGACCAGTCATTGGTGGTTTTGCAGGTCAACTTTCGGTACAGGCACCG
TTTATGTTCGCTGCTGCCATTAACGGGCTGGCATTTCTGGTCTCCCTATTCATTTTACATGAGACCCATAATGCTAATCA
GGTTAGTGACGAGATAAAGAATGAAACAATCAATGAAACCACATCCTCCATACGCGAGATGATCTCCCCATTATCGGGAT
TGCTAGTTGTCTTTTTCATCATTCAATTGATTGGCCAAATCCCTGCAACATTATGGGTTTTATTCGGAGAAGAGCGCTTC
GCATGGGATGGCGTAATGGTCGGTGTTTCATTGGCTGTGTTTGGGCTTACACACGCTCTGTTTCAAGGACTTGCTGCTGG
TTTTATCGCTAAACATTTGGGAGAACAGAGAGCTATCGTGGTTGGCATCTTGGCTGATGGCTGTGGCCTACTTTTATTGG
CAGTCATTACGCAAAGCTGGATGGTTTGGCCAGTTGTGCTGTTACTCGCTTGTGGTGGCATAACTCTTCCCGCTTTGCAG
GGAATTATATCTGTTCGTGTCGGTCAGGTAGCACAGGGACAATTGCAAGGGTTGCTGACCAGTTTGACACACCTCACGGG
TGTAATCGGTCCACTTATTTTTGCATTTTTGTATAGTGCAACCCACGAATCTTGGAATGGTTGGGTGTGGATAGTTGGAT
GCGGATTGTATGTAGTTGCACTGACTATACTGAGGTTTTTCTATCCCGGCAGGGCAGTCCACCCGAAAAATCAGAGCAAT
TCACAGCCATTTCTTTAA

>>MEG_7073|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETE
ATGAACCGCACTGTGATGATGGCACTGGTCATCATTTTTTTAGATGCTATGGGGATTGGCATAATTATGCCTGTCTTGCC
GGCGTTATTACGGGAGTTTGTTGGAAAGGCTAATGTTGCAGAGAACTACGGTGTTTTATTGGCGCTGTATGCAATGATGC
AAGTGATTTTTGCCCCTCTTCTCGGCCGCTGGTCAGATCGCATAGGTCGTCGCCCTGTATTGTTACTTTCACTTTTAGGT
GCAACACTGGACTACGCATTAATGGCAACAGCCAGCGTAGTGTGGGTGTTGTATTTGGGACGCTTAATTGCTGGTATTAC
CGGTGCGACTGGAGCTGTTGCAGCCTCAACAATTGCCGATGTCACACCTGAGGAATCCAGGACACATTGGTTTGGTATGA
TGGGTGCCTGTTTTGGTGGCGGTATGATTGCTGGACCAGTCATTGGTGGTTTTGCCGGTCAACTTTCGGTACAGGCACCG
TTTATGTTCGCTGCTGCTATTAACGGGCTGGCATTTCTGGTCTCCCTATTCATTTTACATGAGACCCATAATGCTAATCA
GGTTAGTGACGAGTTAAAGAATGAAACAATCAATGAAACCACATCCTCCATACGCGAGATGATCTCCCCATTATCGGGAT
TGTTAGTTGTCTTTTTCATCATTCAATTGATTGGCCAAATCCCCGCAACATTATGGGTTTTATTCGGAGAAGAGCGCTTC
GCATGGGATGGCGTAATGGTCGGTGTTTCATTGGCTGTGTTCGGGCTGACACACGCACTGTTTCAAGGACTTGCTGCTGG
TTTTATCGCTAAACATTTGGGAGAACGGAAAGCTATAGCGGTTGGCATTTTGGCTGACGGTTGTGGCCTATTTTTATTGG
CGGTCATTACACAAAGCTGGATGGTTTGGCCGGTTTTGCTGTTACTAGCTTGTGGTGGCATCACACTTCCCGCCTTGCAG
GGAATTATATCTGTTCGTGTCGGTCAGGTAGCACAGGGACAATTACAAGGGGTGCTGACCAGTTTGACCCACCTGACAGC
TGTAATCGGTCCACTTGTTTTTGCATTTTTGTATAGTGCAACCCGCGAAACGTGGAATGGATGGGTATGGATAATTGGCT
GCGGATTATATGTAGTTGCATTGATTATACTGAGGTTTTTCCATCCAGGTAGGGTAATCCACCCGATAAATAAGAGCGAT
GTACAGCAGAGAATTTGA

>>MEG_7074|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETE
GTGATGATGGCACTGGTCATCATTTTTTTAGATGCTATGGGGATTGGCATAATTATGCCTGTCTTGCCGGCGTTATTACG
GGAGTTTGTTGGAAAGGCTAATGTTGCAGAGAACTACGGTGTTTTATTGGCGCTGTATGCAATGATGCAAGTGATTTTTG
CCCCTCTTCTCGGCCGCTGGTCAGATCGCATAGGTCGTCGCCCTGTATTGTTACTTTCACTTTTAGGTGCAACACTGGAC
TACGCATTAATGGCAACAGCCAGCGTAGTGTGGGTGTTGTATTTGGGACGCTTAATTGCTGGTATTACCGGTGCGACTGG
AGCTGTTGCAGCCTCAACAATTGCCGATGTCACACCTGAGGAATCCAGGACACATTGGTTTGGTATGATGGGTGCCTGTT
TTGGTGGCGGTATGATTGCTGGACCAGTCATTGGTGGTTTTGCCGGTCAACTTTCGGTACAGGCACCGTTTATGTTCGCT
GCTGCTATTAACGGGCTGGCATTTCTGGTCTCCCTATTCATTTTACATGAGACCCATAATGCTAATCAGGTTAGTGACGA
GTTAAAGAATGAAACAATCAATGAAACCACATCCTCCATACGCGAGATGATCTCCCCATTATCGGGATTGTTAGTTGTCT
TTTTCATCATTCAATTGATTGGCCAAATCCCCGCAACATTATGGGTTTTATTCGGAGAAGAGCGCTTCGCATGGGATGGC
GTAATGGTCGGTGTTTCATTGGCTGTGTTCGGGCTGACACACGCACTGTTTCAAGGACTTGCTGCTGGTTTTATCGCTAA
ACATTTGGGAGAACGGAAAGCTATAGCGGTTGGCATTTTGGCTGACGGTTGTGGCCTATTTTTATTGGCGGTCTTTACAC
AAAGCTGGATGGTTTGCCCGGTTTTGCTGTTACTAGCTTGTGGTGGCATCACACTTCCCGCCTTGCAGGGAATTATATCT
GTTCGTGTCGGTCAGGTAGCACAGGGACAATTACAAGGGGTGCTGACCAGTTTGACCCACCTGACAGCTGTAATCGGTCC
ACTTGTTTTTGCATTTTTGTATAGTGCAACCCGCGAAACGTGGAATGGATGGGTATGGATAATTGGCTGCGGATTATATG
TAGTTGCATTGATTATACTGAGGTTTTTCCATCCAGGTAGGGTAATCCACCCGATAAATAAGAGCGATGTACAGCA

>>MEG_7075|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETE
AACCTTTTAATGCTATGGGGGATTGGCATAATTATGCCTGTCTTGCCGGCGTTATTACGGGAGTTTGTTGGAAAGGCTAA
TGTTGCAGAGAACTACGGTGTTTTATTGGCGCTGTATGCAATGATGCAAGTGATTTTTGCCCCTCTTCTCGGCCGCTGGT
CAGATCGCATAGGTCGTCGCCCTGTATTGTTACTTTCACTTTTAGGTGCAACACTGGACTACGCATTAATGGCAACAGCC
AGCGTAGTGTGGGTGTTGTATTTGGGACGCTTAATTGCTGGTATTACCGGTGCGACTGGAGCTGTTGCAGCCTCAACAAT
TGCCGATGTCACACCTGAGGAATCCAGGACACATTGGTTTGGTATGATGGGTGCCTGTTTTGGTGGCGGTATGATTGCTG
GACCAGTCATTGGTGGTTTTGCCGGTCAACTTTCGGTACAGGCACCGTTTATGTTCGCTGCTGCTATTAACGGGCTGGCA
TTTCTGGTCTCCCTATTCATTTTACATGAGACCCATAATGCTAATCAGGTTAGTGACGAGTTAAAGAATGAAACAATCAA
TGAAACCACATCCTCCATACGCGAGATGATCTCCCCATTATCGGGATTGTTAGTTGTCTTTTTCATCATTCAATTGATTG
GCCAAATCCCCGCAACATTATGGGTTTTATTCGGAGAAGAGCGCTTCGCATGGGATGGCGTAATGGTCGGTGTTTCATTG
GCTGTGTTCGGGCTGACACACGCACTGTTTCAAGGACTTGCTGCTGGTTTTATCGCTAAACATTTGGGAGAACGGAAAGC
TATAGCGGTTGGCATTTTGGCTGACGGTTGTGGCCTATTTTTATTGGCGGTCATTACACAAAGCTGGATGGTTTGGCCGG
TTTTGCTGTTACTAGCTTGTGGTGGCATCACACTTCCCGCCTTGCAGGGAATTATATCTGTTCGTGTCGGTCAGGTAGCA
CAGGGACAATTACAAGGGGTGCTGACCAGTTTGACCACCTGACAGGTGTAATCGGGCCACTTGTTTTTGCATTTTTGTAT
AGTGCACCCCCCAAACGTGAAATGAATGGGTATGAATATTGGCCGCCGATATATGTAGTTGCATTGATATACTGAAGTTT
TTCCTCCCGGTAGGGTACCCCCCCATAATAAACGCGGTTTTCCCCCAAAA