MEGAResFrom MEG, the Microbial Ecology Group

FABG

The FABG group of genes confer resistance to Triclosan through the mechanism, Triclosan-resistant mutation.

References

    Sequences

    Download Sequences

    >>MEG_2873|Biocides|Phenolic_compound_resistance|Triclosan-resistant_mutation|FABG|RequiresSNPConfirmation
    ATGAATTTTGAAGGAAAAATCGCACTGGTAACCGGTGCAAGCCGCGGAATTGGCCGCGCAATTGCTGAAACGCTCGCAGC
    CCGTGGCGCGAAAGTTATTGGCACTGCGACCAGTGAAAATGGCGCTCAGGCGATCAGTGATTATTTAGGTGCCAACGGCA
    AAGGTCTGATGTTGAATGTGACCGACCCGGCATCTATCGAATCTGTTCTGGAAAAAATTCGCGCAGAATTTGGTGAAGTG
    GATATCCTGGTCAATAATGCCGGTATCACTCGTGATAACCTGTTAATGCGAATGAAAGATGAAGAGTGGAACGATATTAT
    CGAAACCAACCTTTCATCTGTTTTCCGTCTGTCAAAAGCGGTAATGCGCGCTATGATGAAAAAGCGTCATGGTCGTATTA
    TCACTATCGGTTCTGTGGTTGGTACCATGGGAAATGGCGGTCAGGCCAACTACGCTGCGGCGAAAGCGGGCTTGATCGGC
    TTCAGTAAATCACTGGCGCGCGAAGTTGCGTCACGCGGTATTACTGTAAACGTTGTTGCTCCGGGCTTTATTGAAACGGA
    CATGACACGTGCGCTGAGCGATGACCAGCGTGCGGGTATCCTGGCGCAGGTTCCTGCGGGTCGCCTCGGCGGCGCACAGG
    AAATCGCCAACGCGGTTGCATTCCTGGCATCCGACGAAGCAGCTTACATCACGGGTGAAACTTTGCATGTGAACGGCGGG
    ATGTACATGGTCTGA