MEGAResFrom MEG, the Microbial Ecology Group

PEXA

The pexA gene encodes a chloramphenicol efflux pump.

References

Other Groups in Phenicol efflux pumps

Sequences

Download Sequences

>Phe|PexA|HM537013|14055-25302|1248|Phenicol|Phenicol_efflux_pumps|PEXA
ATGAAAAAGTTTGTACTTTTTTGCGAGCGTAATGGAATCGCTTTGATTCCGATCGTTTTGATCCTTTTGGGTTGTGGTCT
TTGGCCAGAGATGGAACTTTTGGTTCCGAGTTTGCCTGACATGCAGCGTGCCTTTAACATCCAAGATGCGCAGATTCAAC
AGTTGCTGACTGCAAATTTTGTCGGATTTCTTATCGGTGTTCTCTTTGCGGGTCCCCTTTGTGACAGTGCAGGTCGAAGA
ACCGTAATGATGATAGGGACGATAGGTTACCTTGTTTCGTCCGTGCTTTGTCCGTTTTGTAACGACTTTGTGCTTTTAAT
GATTGCCCGATTTTTCCAAGGCTTGTTCATGACGGGGCCGGTCATTGCCGGTGGTGTCCTCTTGATGGAAGCCACGGAAG
GGGTGAAACAAATCTTTTGGATGTCGATTGGTAATGCAGCTATTACGTTTTGCATGGCTGCAGGACCTATTGTTGGATCT
TGGATCAATACAGGTTTTGGCTATGTTGGAAATCTGTGGAGCATTCTCATCCTTGGTTTGATTGGCTGCCTTCCTGCGTT
ATTTTTAGTGCCGGAAAGTCTTCCAGTTGAGAAGCGAGCAGCTTTCCATCCCAAACTACTTTTCAAAGGGTATTTTGCGC
TATTGAAAGATTTTAGGTTTATGTGTCTTGCGATTCCCATGTGCGCACTAGCGGCAGCCTATTGGATCTACGTCGGTGTA
AGTGCCTTATACATGGTGAATCAGTTGGGAATTGCGCAAGAGATGTTCGGTCGTTATCAAGGACCTATCGTTGGTTGCTT
CTCGATAATCTCTCTTGGCTCTTCGAAACTTCTTCAGCGCTTTGGTTTGATGAAATGCCTACGTGCAGGAATTGTTTCCA
TGTTCACGGGTATGCTTCTTCTTTTAGGCATGAGCATTCTTTCTTTGGATCATGCAGTAGCGACAACGGTGTTTATGATG
TTCTTCGTTGGAGGAATGGCACCGATTTGCAGCATGCTTTTCCCATATGCTTTGGGACATTTGCCTGTCGATCTAAAAGG
GAATGCACAAGCCATGGTACAAGCGATTAGACTCTTTTTCGCATCAATTGGTACTTCCTTGGTTGGTGTCTTCTACAAAA
GTGCTTTTTTGCCAGTAGCCCTGATTATGTTCGCCATTCTTCTCTTCAGTTGCTACTTCCTTTGGAAGGGAAGACGTTAC
TTGAAAGAAGGTCTTGGTGCGGATCATATTTTGAGCGTTGGTCACTAG