MEGAResFrom MEG, the Microbial Ecology Group

MDTP

The mdtP gene encodes a multi-drug efflux pump in Escherichia coli.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|AP009048|4303042-4304509|ARO:3003550|mdtP|Multi-drug_resistance|Multi-drug_efflux_pumps|MDTP
TTATTTTTTCTCGACGACGGGACCTGCCTGATACCCGCCGCCCAGCGATTTCATCAACTGAATGCTTTGGATCACCCGGC
GGCTGTCCAGCATCAGTAATGACATCTCTTCGGCAAGCACTGGCAACCGGGCTTCGGTGGCCTGTAAGCGGCTGGTTAAG
CCGCGCTGATAGGCGGCCTCGGCAGCGCGCTGGGTAAAGCGCGTGGCTTCCACGCGTTCAGCCTGCATTTCTCGCTCGTC
GTTGAGCGTTTGCAGACGCGTGCCGTTGACGGCAACGTCACGCACCGCGTTCAGTACTGACTGGTTGTAACGTTCAATCA
TCATGTTGCTGGCGGCGCGCGTGCCTTCGAGATTGGCATTCAACCGTCCACCGTCAAACAGCGGCAATTTCAGACCCGGG
ATGAAGTTGAACTGGCGACTGGTTTTTTTGAATAAGGTATGCAGATGGATGGAGTCCAGACCGAAAAACGCTTTGATATC
AAAGCTCGGATAGAACAACGCCCGCGCGGAATCCACCTGATCTAATGACGCCTGAACATACCAGCGCATGGCTTGCAGAT
CCGGGCGTCTGGCGAGCAACTCATAAGAGAGTGTCGCCGGAATGCCGGTCTGGACTTGCGGTAATGCCACCGGTCTGATC
TCCGGCATATCGCTGGCTCCCGCGCCAATCAATGCACGCAGAGATTCTCGCGTTTCGGTGATTTGCCCTTTGACGGCAAC
AATTTGTTTATCGACCGCCAGAATCTGTGCCCGCGCGCCGTGGAAAGGCACTTGCGCTTCCAGACCGTGCGCCACTTTAC
TCTGGTGCGCTTTCACCGCGTAATCAATCACATCGTGAGTTTGTTCTAACAGATCGAGCATCTGATAGCTGGCCTGCATA
CTGTAATAAAGCTGCGCTACGCCCGTGGCCAGCGATAGCTCTACTGCTGCGGTTTCTGCCAGCGCGGCATTATGCGCGCC
AATGGCGGCGGCAACCGCTGAGCGATGCACACCCCACAAATCAAGATCCAGTCCGGCAAACAAACCTACTGTGGCTTCCG
TATAGTACGGCCCGTCCATACCCAGTGCTGGCGCATCCATTGAATAAGGGCTTAAAAAGCCGTTCGCCGAGACACGTTGG
CGGTTGAGCATCCCTAACGCTGCGACCTGTAATTGTGAACCGGCATCTAACAAATCGGCCTGGGACTGCGCTTTTTCTTC
CCGCAGTTTCGCTTCGGCGAGGGTGTGTGAACCACTTAGCGTCCGTTGGATCAGCGCATCCAGCTGCGGGTCATTGAGTT
GTTTCCACCACTGCGCCTGCGGCCAGCCGGAGCTGGCAAGATGAATATCGTCGGCCAGTTTGATTTGTTCCGGTTTGAGC
TGTTGATGAGGTGCAGAATCCTTACGTACCAGGGCACAGCCGGAAATCAGCGTCGTGCTGCCGAGAATGCTGCACAACAG
CAGACGTGAAAGTTGACGATTGATCAT