MEGAResFrom MEG, the Microbial Ecology Group

ASMA

The asmA gene is hypothesized to control expression of the marRAB operon in Salmonella enterica.

References

  • http://jb.asm.org/content/191/11/3615.full

Other Groups in Multi-drug RND efflux regulator

Sequences

Download Sequences

>>MEG_1179|Drugs|Multi-drug_resistance|Multi-drug_RND_efflux_regulator|ASMA
ATGATCCTGCTGGCGGTCATTGTCGCCGGGCTTACCTCGTTGGTATTGCTGGTCAATCCCAACGATTTTCGCGCCTATAT
GGTGCATGAGGTGGCAGAGCGCAGCGGTTATCAGCTTGACCTTGATGGCCCGCTGCGCTGGCACGTCTGGCCGCAGCTCA
GCATTCTCAGCGGACGGATGACGCTGACCGCCCGAGGCGCCGAAGAGCCGGTGATCCGCGCCGACAATATGCGCCTCGAC
GTGGCGCTGCTGCCGCTGCTCTCGCATCAGCTGCAGGTTAAGCAGGTGATGCTCAAGGGCGCGGTGATCCAGCTGACCCC
GAAAACCGAGGCGGTTCGCGACAGCTCAGCGCCGGTGGTGCCGCATGACAACACCCTGCCGCTGGCCCCGGAGGATCGCG
GATGGTCCTACGATGTGCGTCAGCTGCAGGTGGCCGACAGCGTGCTCTTCTTCCAGCACGAGAACGGCGAGCAGGTGACC
GTGCGCGATATCCGTCTGCAGATGGAGCAGGATGAGAATCACCGGGCCACCGTGGATTTCTCCGGCCGGGTGAACCGCGA
CCAGCGCGACCTGGCGCTGAACTTCTCCGCCACCGTGCAGGGCGGCGATTATCCGCACTCCTTAAAAGCCGACTTTACCC
AGCTTAGCTGGCAGCTGCGCGGCGCCGAGCTCCCACCGGACGGCATTAATGGTCAGGGGAGTCTGCAGGCCAGCTGGCAG
GAAGATGACAAGACCCTGCGTTTTGACAACCTGAATCTGATGGCTAACCGCAGCACCGTTACCGGCAGCGGCAGCGTGGT
GCTGGGGGATCGCCCGGACTGGTCGCTGGATTTGCACGCCACCACTCTCGATCTCGATAGTCTGCTGGCGCAAAGGTCGC
CGGCGACGGACAGTAGCGCCAGTCAGCAGGGCCAGAGTCAGACGCGACCGCTGCGCCCGGTGATCGCCGACAGCGATGAG
CGCGAAGATTACCAGAGCCTGCGCGGCTTCAACGGCCGAATGGCCCTGAGCGCCGACCAGCTGCAGTGGCGCGGTCTGAA
CTTCACCCAGGTGCAGAGCGAAATCAGCAACCAGCAGGGGCTGCTGACGGTCAGCAAAATGCAGGGCAATCTTGATGGCG
GGCAGCTCTCTCTCCCTGGCACCCTGGATGCCCGCGGCGACACGCCGCTGGCGACGTTCCAGCCGGCGCTGCAGAATGTG
GAGATCGGTTCGCTGATCAAAGCCTTTAACTATTCCTTAAACCTGACCGGCAAGCTGTCGCTGAGCGGCGAATTTTCCGG
AACGCGCATTGACGCCGATGATTTCCGTCGCCACTGGCAGGGACAGGCTCAGCTCCAGATGGCCGATACCCGCACCGAAG
GGCTGAACTTCCAGCAGCTGGTGCAGCAGGCCGTGGAGCGCAGCACCAACGTGCGGGCGCAGGAAAATTACGACAATGCC
ACCCGCCTGGATTCCGTGAGCAGCCGGCTGACGCTGGATAACGGGCTGGTGACGCTGAACCGCCTGCAGGGGCAGTCCGA
CGTGATGGCGATGACCGGCGAAGGACAGCTCGATCTGCAGAAAGAGAACTGCGATATGCGCTTCAACGTGCGCGTGCTCG
GCGGCTGGAAAGGGGAGGGCAAGCTTATCGACCGCCTGAAACAGACCGCTATCCCGCTGCGCATCTACGGCGAGTGGCAG
TCGCTGAGCTACAGTCTGCAGGTCGACCAGATCCTGCGCAAACAGCTGCAGGATGAAGCGAAGCAGCGCCTCAACGACTG
GGTTGAGCGTAATAAAGGCAGCAAAGACGGCAACGATGCCAAAAAGCTGCTCGATAAGCTGTAA

>>MEG_1180|Drugs|Multi-drug_resistance|Multi-drug_RND_efflux_regulator|ASMA
ATGAGACGATTTCTGACGACGCTGATGATACTCCTGGTCGTGCTGGTGGCCGGGTTATCTGCGTTAGTGTTGCTGGTGAA
TCCGAATGATTTCCGCGACTATATGGTCAAGCAAGTTGCTGCACGTAGCGGTTATCAATTGCAGCTCGACGGGCCACTGC
GTTGGCACGTCTGGCCGCAACTTAGTATCCTCTCCGGGCGAATGTCTCTCACCGCCCAGGGCGCGAGCCAGCCACTGGTT
CGCGCCGACAACATGCGCCTGGACGTGGCGCTTTTACCACTACTGAGTCATCAACTGAGCGTTAAGCAGGTGATGCTAAA
AGGGGCAGTGATCCAACTGACGCCGCAGACGGAAGCGGTGCGCAGTGAAGACGCTCCGGTTGCACCGCGCGACAATACCT
TGCCGGATCTGTCAGACGATCGCGGATGGTCGTTTGATATATCCAGTCTTAAGGTGGCGGACAGCGTTCTGGTGTTCCAG
CATGAAGATGACGAGCAGGTGACAATCCGCAATATCCGCCTGCAAATGGAACAAGATCCCCAACATCGTGGCTCATTTGA
GTTCTCCGGGTGGGTTAATCGCGATCAGCGCGATCTCACGATATCCCTTAACGGTACGGTGGATGCTTCTGATTATCCGC
ATGATTTAACGGCTGCTATTGAACAAATTAACTGGCAGTTGCAGGGTGCCGATTTACCAAAACAAGGCATTCAGGGGCAG
GGGAGTTTCCAGGCCCAGTGGCAGGAGTTACATAAACGCCTTTCATTTAACCAAATCAGCTTGACCGCCAATGACAGTAC
GCTGAGTGGGCAAGCACAGGTTACGCTGACAGAGAAACCGGAATGGCAGCTGAGGCTGCAATTCCCGCAACTGAATCTTG
ACAACCTCATCCCGCTTAATGAAACAGCGAATGGTGAAAACGGTGCCGCGCAGCAGGGGCAGAGCCAATCAACGTTGCCG
CGCCCGGTTATTTCTTCGCGTATTGATGAACCGGCCTATCAGGGACTGCAAGGCTTTACGGCTGATATTTTGTTGCAGGC
CAGTAACGTGCGCTGGCGCGGAATGAATTTTACAGATGTTGCCACGCAAATGACCAACAAGTCGGGTTTGCTGGAAATTA
CTCAACTGCAGGGCAAGCTTAACGGTGGACAGGTTTCACTGCCGGGCACGCTGGACGCGACATCAATAAATCCGCGGATA
AACTTCCAGCCACGGCTGGAAAACGTTGAGATTGGCACCATTCTGAAGGCGTTTAACTATCCGATTTCGTTGACCGGAAA
GATGTCACTGGCTGGTGATTTCTCCGGTGCTGACATAGATGCCGACGCATTCCGCCACAACTGGCAAGGACAGGCACATG
TCGAAATGACCGACACGCGCATGGAAGGGATGAACTTCCAGCAGATGATTCAGCAAGCGGTAGAACGTAATGGTGGTGAT
GTGAAGGCCGCTGAAAACTTCGATAACGTAACGCGTCTTGAGCGCTTTACCACCGATTTGACGTTGAAGGCTGGCGTCGT
GACGTTAAACGACATGCAAGGTCAATCGCCTGTGCTGGCGCTTACAGGGGAAGGTATGTTGAATCTGGCAGCTCAAACCT
GCGACACCCAGTTTGATCTTCGGGTCGTGGGTGGCTGGAACGGGGAAAGCAAACTGATTGATTTCCTCAAAGAAACGCCA
GTACCGCTGCGGGTTTATGGCAACTGGCAGCAACTCAATTACAGTCTGCAAGTGGATCAGTTACTGCGCAAACATCTACA
GGACGAAGCGAAACGTCGCCTGAATGACTGGGCCGAGCGGAATAAAGATTCCCGCAATGGCAAAGATGTGAAGAAGTTGC
TGGAGAAGATGTAA