MEGAResFrom MEG, the Microbial Ecology Group

VGAD

The vgaD gene encodes an efflux pump that has demonstrated activity against streptogramin A antibiotics.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/20713681

Other Groups in Multi-drug ABC efflux pumps

Sequences

Download Sequences

>MEG_7702|Drugs|Multi-drug_resistance|Multi-drug_ABC_efflux_pumps|VGAD
ATGCTCATTCTTGAAGCGAATCATATTGAAAAATCTATAAATGACCGGAAACTTTTAGATGTTACTCATCTACAAATTCA
TTATGAGGATCGGATTGGTGTAGTTGGTCGTAATGGAAGCGGGAAAACGACATTATTATCTATATTGGCTGGTGAAATAG
AAGCAGATAAAGGTGAAGTGAAAACAAGTGCAAGTCGCTACTTTTTACCTCAATTGAAGGAGACGGATACTTTCAGAAGT
GGTGGTGAGATAACAAAAAGCTATATTGACAAAGCATTAGCGATGAAGGCGGAAATATTGTTTGCCGACGAACCAACTAC
AAACCTTGATACCCACAATATAAAAGAACTTGAAAAGCATTTCAGTCGATATCGGGGGGCAATCATTCTTGTATCACATA
ACCGGTATTTTTTAGATCAAATTTGTACAAAAATATGGGAAATTGAAGATGGAGAAGTGAAAGAAATTCACGGTAACTAT
ACAAGTTATGTAAAACAAAAAGAACTACTTCGTCGACAGCAACAAGAGGAATATGAAAAATATATAACGAAGAAAAAGCA
ACTGGAGCGAGCTGTTACCATGAAAGAACAAAAGGCGCAAAAAATGATTAAGCCTCCTTCTAAACAAATGGGTACTTCTG
AATCTCGAATATGGAAGATGCAGCATGCGACTAAACAAAAGAAAATGCATCAAAATATTAAGGCTCTTGAAACACGTGTT
GAAAAACTAGAGCGTGTGAAAAAACCAAAAGATTATCCGGCTGTCAAAATGAAGTTGTCTAACCAAGATCAAATACAGGG
GCGCAATGTACTTCGGGTAAAAGACTTATCTGTTTCCTTTGGGAATCATGTGCTTTGGACAGATGCTTCTTTTACCATTA
AAGGCGGGGAGAAGGCTGCCATTATTGGCAATAATGGGGTCGGTAAAACAACATTGTTGAAACAAATTTTAGAAAGGGTA
CCAGCGGTAACAATATCACCCGCAGCAAAAATCGGCTATTTTAGCCAGAATTTGGATACGCTTGATACGCATGTGTCGAT
CTTAGAAAATGTCATGTCCACCGCTATTCAAGATGAAACTACTGTACGGACTGTTCTCGCAAGATTACATTTCTACCGGG
AGGATGTTTATAAGGAAGTTCAAGTCCTAAGTGGTGGGGAACGTGTGAAGGTTGCTTTTGCAAAACTATTTGTTAGCGAC
TATAATACGTTGATTCTGGATGAACCAACAAATTATTTAGACATTGATGCCATAGAAGCGTTAGAGGAGCTCCTAATTAA
CTATGAGGGGGCAGTACTATTTGTATCTCATGATTGTCGTTTCGTTCAAAATATTGCATCCAAAATTATTGAACTATCCG
ACCAGAAGGTTATAGAGTTTCTTGGAAGCTATAAAGCGTTTAGAGAAAGATCTCAAGAGACAGAGCGTGACTATATGAAG
GAAGAACTTCTTAAAATTGAGATCAAACTCACTCAAATGATTAGTGAAATGAATGACGAGGCATCAAATGAATTAGAAAA
AGAATTCCAAATGTTGATTCATGAACGTAATCAGTTAAGAAATCAAGTAAACAATTAG