MEGAResFrom MEG, the Microbial Ecology Group

HNS

The H-NS protein is a histone-like protein that participates in global gene regulation. It has been implicated in the expression of several multi-drug efflux systems, including acrEF, mdtEF, and emrKY.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|NC_002695|1737553-1737967|ARO:3000676|H-NS|Multi-drug_resistance|MDR_regulator|HNS
TTATTGCTTGATCAGGAAATCGTCGAGGGATTTACCTTGCTCATCCATTGCTTTTTTGATTACAGCTGGAGTACGGCCCT
GGCCAGTCCAGGTTTTAGTTTCGCCGTTTTCGTCAACGTAGCTATATTTTGCCGGACGCTGAGCACGTTTAGCTTTGGTG
CCAGATTTAACGGCGGCAAGGCTATTCAGCAGCTCGTTCGGGTCAATACCGTCAGCGATCAGCATTTCGCGATATTGCTG
CAGTTTACGAGTGCGCTCTTCAACTTCAGCAGCAGCCGCGCTTTCTTCTTCGCGACGTTCGTTAACAACAACTTCTAATT
TTTCCAGCATTTCTTCCAGCGTTTCAAGTGTACATTCTCTTGCCTGCGCACGAAGAGTACGGATGTTGTTCAGAATTTTA
AGTGCTTCGCTCATT