MEGAResFrom MEG, the Microbial Ecology Group

SRMB

The srmB gene encodes a spiramycin efflux pump.

References

Sequences

Download Sequences

>CARD|phgb|X63451|0-1653|ARO:3002828|srmB|MLS|Spiramycin_efflux_pumps|SRMB
GTGTCGATTGCGCAATACGCCCTACACGACATCACGAAGCGCTACCACGACTGTGTCGTGCTCGACCGGGTCGGTTTCAG
CATCAAGCCGGGCGAGAAGGTCGGCGTGATCGGCGACAACGGTTCCGGCAAGTCCACGCTGCTCAAGATCCTCGCCGGCC
GCGTGGAGCCCGACAACGGCGCGCTCACCGTGGTCGCTCCCGGCGGCGTCGGCTACCTGGCGCAGACACTGGAACTGCCC
CTCGACGCCACCGTCCAGGACGCCGTCGACCTGGCCCTGTCCGACCTGCGCGAGCTCGAAGCGGCGATGCGCGAGGCCGA
GGCGGAGCTGGGCGAGAGCGACGAGAACGGCTCCGAGCGCGAGCTGTCCGCCGGCCTCCAGCGCTACGCCGCTCTGGTCG
AGCAGTACCAGGCGCGTGGCGGCTACGAGGCCGACGTGCGCGTGGAGGTCGCGCTGCACGGCCTCGGACTGCCGAGCCTG
GACCGCGACCGCAAGCTCGGAACCCTCTCCGGTGGCGAACGCTCCCGCCTCGCGCTCGCCGCGACCCTCGCCTCGTCGCC
GGAGCTGCTGCTCCTGGACGAACCGACCAACGACCTCGACGACCGGGCGATGGAATGGCTGGAGGACCACCTGGCCGGCC
ACCGCGGCACGGTGATCGCGGTCACCCACGACCGGGTCTTCCTCGACCGGCTCACCACCACGATCCTGGAGGTCGACTCC
GGCAGCGTCACCCGCTACGGCAACGGCTACGAGGGCTACCTGACGGCCAAGGCCGTGGAACGCGAGCGGCGGCTGCGGGA
GTACGAGGAGTGGCGTGCCGAACTCGACCGCAACCGCGGGCTGATCACCTCCAACGTGGCGCGGATGGACGGCATCCCGC
GCAAGATGTCCCTCTCCGTGTTCGGCCACGGCGCCTACCGCAGGCGAGGGCGCGACCACGGCGCGATGGTGCGGATCCGC
AACGCGAAGCAACGCGTGGCGCAGCTGACCGAGAACCCGGTCCACGCTCCCGCCGACCCGTTGTCCTTCGCCGCCCGCAT
CGACACCGCGGGCCCGGAGGCGGAGGAGGCGGTGGCCGAACTCACCGACGTGCGCGTCGCGGGTCGGCTCGCCGTGGACT
CCCTGACGATCCGGCCCGGCGAACGGCTGCTCGTCACAGGTCCCAACGGTGCGGGCAAGTCCACCTTGTTGCGGGTGCTG
TCCGGGGAACTGGAGCCGGACGGCGGCTCGGTGCGCGTCGGCTGCCGGGTCGGTCATCTGCGGCAGGACGAGACGCCCTG
GGCGCCCGGACTGACCGTGCTGCGGGCCTTCGCCCAGGGCCGGGAGGGCTACCTGGAGGACCACGCGGAGAAACTGCTGT
CGCTCGGCCTGTTCAGCCCGTCCGACCTGCGGCGACGCGTGAAGGATCTGTCCTACGGGCAGCGCCGCCGGATCGAGATC
GCCCGGCTGGTGAGCGACCCGATGGACCTGCTGCTGCTGGACGAGCCCACCAACCACCTCACCCCGGTGCTGGTGGAGGA
GTTGGAGCAGGCACTCGCGGACTACCGCGGCGCCGTCGTGGTCGTCACCCACGACCGTCGGATGCGGTCCCGGTTCACCG
GCGCCCGGCTGACCATGGGAGACGGGCGCATCGCCGAGTTCAGCGCCGGCTGA