MEGAResFrom MEG, the Microbial Ecology Group

MSRD

The msrD gene encodes an ABC efflux pump that has been shown to function on MLS compounds.

References

  • http://aac.asm.org/content/44/4/967.full

Other Groups in MLS resistance ABC efflux pumps

Sequences

Download Sequences

>>MEG_4073|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|MSRD
ATGGAATTAATATTAAAAGCAAAAGACATTCGTGTGGAATTCAAAGGACGCGATGTTTTAGATATAAATGAATTAGAAGT
ATATGATTATGACCGTATTGGTTTAGTAGGAGCAAATGGTGCTGGAAAAAGCACTTTACTCAGGGTACTTTTAGGAGAAT
TAACTCCCCCAGGATGTAAAATGAATCGTCTGGGTGAACTTGCCTATATTCCCCAGTTGGACGAAGTAACTCTGCAGGAG
GAAAAAGATTTTGCACTTGTAGGCAAGCTAGGTGTTGAGCAATTAAATATACAGACTATGAGCGGTGGTGAAGAAACAAG
GCTTAAAATAGCACAGGCCTTATCGGCACAGGTTCATGGTATTTTAGCGGATGAACCTACGAGCCATTTAGACCGTGAAG
GAATTGATTTTCTAATAGGACAGCTAAAATATTTTACAGGTGCACTGTTAGTTATTAGCCATGACCGCTATTTTCTTGAT
GAAATAGTAGATAAAATATGGGAACTGAAAGATGGCAAAATCACTGAGTATTGGGGAAACTATTCTGATTATCTTCGTCA
GAAAGAGGAAGAACGTAAGAGCCAAGCTGCAGAATACGAACAATTTATTGCGGAACGTGCCCGATTGGAAAGGGCTGCGG
AGGAAAAGCGAAAACAGGCTCGTAAAATAGAACAGAAGGCAAAAGGTTCTTCAAAGAAAAAAAGTACTGAAGACGGAGGG
CGTTTAGCTCATCAAAAATCAATAGGAAGTAAGGAAAAAAAGATGTATAATGCTGCTAAAACCCTAGAGCACAGGATTGC
GGCCTTAGGAAAAGTAGAAGCTCCGGAAGGCATTCGCAGAATTCGTTTCAGGCAAAGTAAAGCATTGGAGCTCCATAATC
CATACCCTATAGTCGGTGCAGAAATTAATAAAGTATTTGGGGATAAGGCTCTGTTTGAAAATGCATCTTTTCAAATTCCG
TTAGGAGCAAAAGTGGCGTTAACTGGTGGTAATGGAATCGGAAAAACAACTTTAATCCAAATGATCTTAAACCATGAAGA
AGGAATTTCTATTTCGCCTAAGGCAAAAATAGGTTACTTTGCACAGAATGGTTACAAGTACAACAGTAATCAGAATGTTA
TGGAGTTTATGCAGAAGGATTGTGACTACAATATATCAGAAATTCGTTCAGTGCTAGCATCTATGGGGTTCAAACAGAAC
GATATTGGAAAAAGTTTATCTGTTTTAAGCGGTGGAGAAATTATAAAATTGTTGCTTGCTAAAATGCTCATGGGTAGATA
TAACATCCTAATAATGGATGAACCCAGTAACTTCCTTGACATACCAAGTTTAGAGGCTTTGGAAATACTAATGAAGGAGT
ACACCGGAACTATCGTGTTTATCACCCACGATAAACGATTACTCGAAAATGTAGCAGATGTAGTTTATGAAATTAGAGAT
AAGAAAATAAATCTGAAACATTAA

>>MEG_4074|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|MSRD
ATGGAATTAATATTAAAAGCAAAAGACATTAGTGTGGAATTCAAAGGACACGATGTTTTAGATATAAATGAATTAGAAGT
ATATGATTATGACCGTATTGGTTTAGTAGGAGCAAATGGTGCAGGAAAAAGCACTTTATTCAAGGTACTTTTAGGAGAAT
TAATTCCCCCAGGATGTAAAATGAATCATCTGGGTGAACTTGCCTATATTCCCCAGTTGGACGAAGTAACTCTGCAGGAG
GAAAAAGATTTTGCGCTTGTAGGCAAGCTAGGTGTTGAGCAATTAAATATACAGACCATGAGCGGTGGTGAAGAAACAAG
GCTTAAAATAGCACAGGCCTTATCGGCACAGGTTCATGGTATTTTAGCGGATGAACCTACGAGCCATTTAGACCGTGAAG
GAATTGATTTTCTAATAGGACAGCTAAAATATTTTACAGGTGCACTGTTAGTTATTAGCCATGACCGCTATTTTCTTGAT
GAAATAGTAGATAAAATATGGGAACTGAAAGATGGCAAAATCACTGAGTATTGGGGAAACTATTCTGATTATCTTCGTCA
GAAAGAGGAAGAACGTAAGAGACAAGCTGCAGAATACGAACAATTTATTGCGGAACGTGCTCGATTGGAAAGGGCTGCGG
AGGAAAAGCGAAAACAGGCTCGTAAAATAGAACAGAAGGCAAAAGGTTCTTCAAAGAAAAAAAGTACTGAAGGCGGAGGG
CGTTTAGCTCATCAAAAATCAATAGGAAGTAAGGAAAAAAAGATGCATAATGCCGCTAAATCCCTAGAGAACAGGATTGC
GGCATTAGGAAAAGTAGAAGCTCCGGAAGGCATTCGCAGAATTCGTTTCAGGCAAAGTAAAGCATTGGAGCTCCATAATC
CATACCCTATAGTCGGTGCGGAAATTAATAAAGTATTTGGGGATAAGGCACTGTTTGAAAATGCATCTTTTCAAATTCCG
CTAGGAGCAAAAGTGGCATTAACGGGTGGTAATGGAACCGGAAAAACAACTTTAATCCAAATGATCTTAAACCATGAAGA
AGGAATTTCTATTTCACCTAAGGCAAAAATAGGTTACTTTGCACAGAATGGTTACAAGTACAACAGTAATCAGAATGTTA
TGGAGTTTATGCAGAAGGATTGTGATTACAATATATCAGAAATTCGTTCTGTGCTAGCATCTATGGGGTTCAAACAGAAC
GATATTGGAAAAAGCTTATCTGTTTTAAGCGGTGGAGAAATTATAAAATTGTTGCTTGCTAAAATGCTCATGGGTAGATA
TAACATCCTAATAATGGATGAACCCAGTAACTTCCTTGACATACCAAGTTTAGAGGCTTTGGAAATACTAATGAAGGAGT
ACACCGGAACTATCGTGTTTATCACCCACGATAAACGATTACTCGAAAATGTAGCTGATGTAGTTTATGAAATTAGAGAT
AAGAAAATTAAGCTGAAACATTAA