MEGAResFrom MEG, the Microbial Ecology Group

MSRC

The msrC gene encodes an ABC efflux pump that has been shown to function on MLS compounds.

References

  • http://aac.asm.org/content/44/4/967.full

Other Groups in MLS resistance ABC efflux pumps

Sequences

Download Sequences

>>MEG_4071|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|MSRC
atggaaaatttagcagtaaatataacaaatctacaagtcagctttggcaaccagctagaactatctattgattctcttcg
tgtctatcagcaagatcgtatagggatcataggagaaaatggtgtcggtaaatcgactttgctcaaactaatagccggtg
aactttttcccgatcatgggaaaatccaaacagagatcaccttcaactacctgcctcaattaacctatctcgctgaagca
aaggacctaaatttggaattagccagtcatttccagttaagactggaagaaacttcagagcggaaatggagcggagggga
agaacgaaagatcgagttgatacgtcttctttcttcttatgaacaagggatgcttctagacgagccaacaacccatctag
atagaaaaagtattgatcgactgattgaagagcttcgttattattatggtacgctggtttttgttagtcatgatcgctat
tttctagatgagctagcatcgaaaatctgggaagtaaaagacggagaaatccgagagttttcggggaattatagtgccta
tctcactcaaaaggaattggagaaaaagactcagctacgagaagcagagtcgatcatgaaagagaaaaaacgattggaaa
aatcgatccaagaaaagaaaaaacaagcggaaaagttggaaaaagtgtccagtaaaaagaaaaagcaacaaatcagaccg
gatcggttgtcttcctctaaacaaaaagacagtgtacaaaaagccatccaaaagaatgcgaaaacattagagagaagact
ccaaaaaataggagaaacaaccaagccgcagcagatgaaacaaatccgttttccagtaccaaaatctcttgaactccaca
gccgctatcccatcatgggacaaaatgtccaattggaaagaagtgggagaacattactggtaaatggtgattttcagttt
tctttaggtaaaaaaatcgcgattgtcggtgaaaatggttcaggtaagacaaccttattggaacatatccgcaaacaagg
agaaggaatccttctctctccgaaagtaagctttcaagtctatcagcaaaaggattatcaaatgacatctgaagaatccg
tcattcgttttgtcatgagacaaacagagttttcggaatcgcttgtccgcagtttgctgaatcacttagggtttgctcag
gaaactctggcgaaaccgttgtgtacgttaagtgggggagaagcgacccgtttgatgattgctttgctttttactaagcc
aagtaatgtgttgctgttagatgaaccgactaatttcattgatatggcaacgatcgaagctttagagaagctgatgcaag
tatatccgggaacgattttgtttacttctcatgattcttactttgtcgagcgtacggctgatgaagtttatgaaataaaa
gggcagaaaataaaaaaagtacttacgagaaatttttaa

>>MEG_4072|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|MSRC
ATGGAAAATTTAGCAGTAAATATAACAAACCTGCAAGTTCGTTTTGGTAACCAGTTAGAATTATCTATTGATTCTCTTCG
TGTCTATCAGCAAGATCGGATAGGAATCATAGGGGAAAATGGAGTCGGTAAAACAACGTTGCTGAAACTGATAGTCGGTG
AACTTATCCCCAATCAAGGGAAAATCCAAACAGAGATCACTTTCAACTATCTGCCTCAATTAACCTATCTTGCTGAGGCA
AAGGACCTAAATTTGGAATTAGCCAGTCATTTCCAGTTGAAACTGGAAGAAACTTCGGAACGGAAATGGAGTGGAGGGGA
AGAACGAAAGATCGAGTTGATACGTCTTCTTTCTTCTTATGAACAAGGGATGCTTCTAGACGAGCCGACAACCCATCTAG
ATAGAAAAAGTATGGATCGACTAATTGAAGAGCTTCGTTATTATTATGGCACGCTGATTTTTGTTAGTCATGACCGCTAT
TTTCTAGATGAGTTGGCAACGAAAGTCTGGGAAGTAAAAGACGGAGAAATCCGAGAGTTTCCGGAGAATTATAGTGCCTA
TCTCACTCAAAGGGAATTGGAGAAAAAGACTCAGCTACGAGAAGCAGAGTCGATCATGAAAGAGAAAAAACGATTGGAAA
AATCGATCCAAGAAAAGAAAAAACAAGCGGAAAAGTTAGAAAAAGTGTCCAGTAAAAAGAAAAAGCAACAAATCAGACCG
GATCGGTTGTCTTCCTCTAAACAAAAAGACAGTGTACAAAAAGCCATCCAAAAGAATACGAAAACATTAGAGAGAAGACT
CCAAAAAATAGGAGAAACAACCAAACCGCAACAGATGAAACAAATCCGTTTTCCAGTACCAAAATCTCTTGAACTCCACA
ATCGTTATCCAATCATGGGACAAAATATCCAATTGGAAAGAAGCGGAAGAACATTACTGATAAATAGCGATTTTCAATTT
TCTTTAGGTAAAAAAATCGCGATTGTCGGCGAAAATGGATCAGGTAAGACAACTTTATTGGAACATATCCGCAAACAAGG
AGAAGGAATCCTTCTCTCTCCGAAAGTAAGCTTTCAAGTATATCAGCAAAAGGATTATCAAATGACATCTGAAGAATCCG
TCATTCGTTTTGTCATGAGACAAACAGAGTTTTCGGAATCACTTGTCCGCAGTTTGTTGAATCATTTAGGGTTTGCTCAG
GAAACTCTGACGAAACCGTTGTGTACGTTAAGTGGGGGAGAAGCGACTCGTTTGACGATTGCTTTGCTTTTTACTAAGCC
AAGTAATGTGTTGCTGTTAGATGAACCGACTAATTTCATTGATGTGGCAACGATCGAAGCTTTAGAGCAGCTGATGCAAG
TATATCCGGGAACGATTTTGTTTACTTCACATGATTCCTACTTTGTCGAGCGTACGGCTGATGAAGTTTATGAAATAAAA
GGGCAGAAAATAAAAAAAGTACTTACGAGAAATTTTTAA