MEGAResFrom MEG, the Microbial Ecology Group

LSA

The lsa gene encodes an ABC efflux pump that has been shown to function on MLS compounds.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3067124/

Other Groups in MLS resistance ABC efflux pumps

Sequences

Download Sequences

>>MEG_3641|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|LSA
atgtccttaataaatgtttcaaatctaactttttcatatgaaggaagttatgacaatatttttgaaaatgtaagttttca
gatagatacagattggaaactcggttttattggaagaaacggacgcggtaaaactactttcttaaatttactgcttggca
aatatgcgtattccggcaatataagttctacagttaagtttgagtattttccttatgatgtggaagataagagtctatat
acaattgaagtaatgaagagtatttgtacggaatgtatggattgggagatttttcgtgaaatatcattgcttgatgttca
agaagatgctttatatcgtccgtttaatacattgtcaaatggtgagcaaacgaaggtccttcttgcagctttattcctta
cagcgagttgtttcctgcttattgatgaacctacaaaccatcttgacatcgatgcacgtaatgtagtgcaaaactatttg
aaacgcaagaaggggtttattttggtatctcatgatagaagcttacttgatcaatgtgttgaccatatactatctatcaa
taaaacgaatatcgaaatccaaaagggaaattttacttcttggtgggagaacaaaacgttacaagataattttgaactgg
cagaaaacaagaaactccttaaagaaataggaaggttgtcttatgcagcaaaacgtagttcaaactggtcaaataaagta
gaaaaaagtaaatatggaacaacaaattctggttcaaaactggataagggttatgttggacataaggctgcaaaagcgat
gaaacgtgccaaaaatattgagtcaagacatcaggaagccgttttacaaaaatcagaactgctccacaacattgaacaat
atgatgacttaaaaatttcaccacttgaatttcacaaagagtgcttaatagaagcgaatgatttatcattgtcttatgga
gataaagaagtatgcagtaatcttaatttcagagtcaatattggtgatagagttgccattatcggaaaaaatgggagtgg
taagtctagtatcctaaaattgattaatggagatgatattaaatttaccggaaattttatgctagcaagtggactaaaaa
tttcttatatttcgcaagatacttcatatttaaaaggtaatctatctgaatttgcctataataataagatcgatgaaact
ctatttaaaacgattcttcgtaaactggattttaatagagagcagtttgataagaacatggtggattttagtgctggtca
gaaaaagaaagtactaattgctaaaagcctttgtgaaagtgcacatttgtatatatgggatgagccattgaactatattg
atattttttcacgtatccaaattgaaaaaatgattttggaatattgtcctacactattgtttgtggagcatgatgatgct
ttttgcaataacatttgtacgaaaaatattaatttaggtttgtag

>>MEG_3642|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|LSA
atgtcgaaaattgaactaaaacaactatcttttgcctatgataatcaagaagcgttgctttttgatcaggcaaatatcac
gatggataccaattggaaattaggattgattggccgcaatggccgtgggaaaacaaccttattaagattgttacaaaagc
agttggattaccaaggagagattcttcatcaagtcgatttcgtctattttccacaaacagttgcagaagaacaacagctc
acttattatgtcttacaagaggtgacttcttttgaacagtggaaattagaacgagaattaacgcttttaaacgttgatcc
tgaagttttatggcgtcccttttcttctttatcaggcggcgaaaagacgaaagttttattaggtcttctttttattgaag
aaaatgcctttcctttaattgacgagccaacaaatcacttagatctagctggcagacaacaagtggctgaatatttgaag
aaaaagaaacacgggtttattttagtcagccacgatcgggcatttgttgatgaagtggttgatcatattttggcgattga
aaaaagtcaattgacgctgtatcaagggaatttttctatttatgaagagcaaaaaaaattaagagatgcttttgaactag
cagaaaatgaaaaaatcaaaaaagaagtcaatcgcttgaaagaaaccgctcgtaaaaaagcggaatggtcgatgaaccgt
gaaggtgataagtacggcaacgctaaggaaaaagggagcggggcgatttttgatacaggagccattggtgcccgggcagc
gcgcgtaatgaagcgctcgaaacatattcaacaacgcgccgaaacacaattagcagaaaaagaaaaactattaaaagatc
ttgagtatattgattctttgtcaatggattatcagccaacgcatcacaaaacattattgacggtggaagagcttcgtcta
ggctacgagaaaaattggctgtttgcgccaatttctttttcaataaacgcgggagaaattgtcggaataacaggaaaaaa
tggctcaggaaaatcgagcttgattcagtatttattggataatttttctggggattcagaaggcgaagccactttggctc
accaattaaccatttcttatgtgcgccaagattatgaagacaatcaaggaactttatccgaatttgcagagaaaaatcag
ttagattacacccaatttttaaataacttacgaaaacttgggatggagcgtgccgttttcactaatcgaattgaacaaat
gagtatggggcaacggaaaaaagtcgaagtagccaaatcattgtctcaatcagcagagctttatatttgggatgaacccc
ttaattacttggatgtgtttaatcatcaacaattagaagcgctaatcttatctgtgaagcctgcaatgctagtgattgag
catgatgcgcatttcatgaagaaaataacggataaaaaaattgtcttgaaatcataa

>>MEG_3643|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|LSA
atgtcgaaaattgaactaaaacaactatcttttgcctatgataatcaagaagtattgctttttgatcaggcaaatatcac
gatggataccaattggaaattaggattgattggccgcaatggccgtgggaaaacaaccttattaagattgttacaaaaac
agttggattaccaaggagagattcttcatcaagtcgatttcgtctattttccacaaacagttgcagaagaacaacagctc
acttattatgtcttacaagaggtgacttcttttgaacagtgggaattagaacgagaattaacgcttttaaacgttgatcc
tgaagttttatggcggcccttttcttctttatcaggcggcgaaaagacgaaagttttattaggtcttctttttattgaag
aaaatgcctttcctttaattgacgagccaacaaatcatttagatctagctggcagacaacaagtggctgaatatttgaag
aaaaagaaacacgggtttattttagtcagccacgatcgggcatttgttgatgaagtggttgatcatattttggcgattga
aaaaagtcaattgacgctgtatcaagggaatttttctatttatgaagagcaaaaaaaattaagagatgcttttgaactag
cagaaaatgaaaaaatcaaaaaagaagtcaatcgcttgaaagaaaccgctcgtaaaaaagcggaatggtcgatgaaccgt
gaaggtgataagtacggcaacgctaaggaaaaagggagcggggcgatttttgatacaggagccattggtgcccgggcagc
gcgcgtaatgaagcgctcgaaacacattcaacaacgcgccgaaacacaattagcagaaaaagaaaaactattaaaagatc
ttgagtatattgatcctttgtcaatggattatcagccaacgcatcacaaaacattattgacggtggaagagcttcgtcta
ggctacgagaaaaattggctatttgcgccactttctttttcaataaacgcgggagaaattgttggaataacagggaaaaa
tggctcaggaaaatcgagcttaattcagtatttattggataatttttctggggattcagaaggcgaagccactttggctc
accaattaaccatttcttatgtgcgccaagattatgaagacaatcaaggaactttatccgaatttgcagagaaaaatcag
ttagattacactcaatttttaaataacttacgaaaacttgggatggagcgtgccgttttcactaatcgaattgaacaaat
gagtatggggcaacggaaaaaagtcgaagtagccaaatcattgtctcaatcagctgaactttatatttgggatgaacccc
ttaattacttggatgtatttaatcatcaacaattagaagcgctaatcttatctgtgaagcctgcaatgctagtgattgag
catgatgcacatttcatgaagaaaataacagataaaaaaattgtcttgaaatcataa

>>MEG_3644|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|LSA
ATGTCGAAAATTGAACTAAAACAACTATCTTTTGCCTATGATAATCAAGAAGCGTTGCTTTTTGATCAGGCAAATATCAC
GATGGATACCAATTGGAAATTAGGATTGATTGGCCGCAATGGCCGTGGGAAAACAACCTTATTAAGATTGTTACAAAAGC
AGTTGGATTACCAAGGAGAGATTCTTCATCAAGTCGATTTCGTCTATTTTCCACAAACAGTTGCAGAAGAACAACAGCTC
ACTTATTATGTCTTACAAGAGGTGACTTCTTTTGAACAGTGGAAATTAGAACGAGAATTAACGCTTTTAAACGTTGATCC
TGAAGTTTTATGGCGGCCCTTTTCTTCTTTATCAGGCGGCGAAAAGACGAAAGTTTTATTAGGTCTTCTTTTTATTGAAG
AAAATGCCTTTCCTTTAATTGACGAGCCAACAAATCATTTAGATCTAGCTGGCAGACAACAAGTGGCTGAATATTTGAAG
AAAAAGAAACACGGGTTTATTTTAGTCAGCCACGATCGGGCATTTGTTGATGAAGTGGTTGATCATATTTTGGCGATTGA
AAAAAGTCAATTGACACTGTATCAAGGGGATTTTTCTATTTATGAAGAGCAAAAAAAATTAAGAGATGCTTTTGAACTAG
CAGAAAATGAAAAAATCAAAAAAGAAGTCAATCGCTTGAAAGAAACCGCTCGTAAAAAAGCGGAATGGTCGATGAACCGT
GAAGGTGATAAGTACGGCAATGCTAAAGAAAAAGGGAGCGGGGCGATTTTTGATACAGGAGCCATTGGTGCCCGGGCAGC
GCGCGTAATGAAGCGCTCGAAACACATTCAACAACGTGCCGAAACACAATTAGCAGAAAAAGAAAAACTATTAAAAGATC
TTGAGTATATTGATCCTTTGTCAATGGATTATCAGCCAACGCATCACAAAACATTATTGACGGTGGAAGAGCTTCGTCTA
GGCTACGAGAAAAATTGGCTATTTACGCCAATTTCTTTTTCAATAAACGCGGGAGAAATTGTCGGAATAACAGGAAAAAA
TGGCTCAGGAAAATCGAGCTTGATTCAGTATTTGTTGGGGGATTTTTCTGGAGATTCAGAAGGAGAAGCCACTCTGGCTC
ACCAATTAACCATTTCTTATGTGCGCCAAGATTATGAAGACAATCAAGGAACTTTATCCGAATTTGCAGAGAAAAATCAG
TTAGATTACACCCAATTTTTAAATAACTTACGAAAACTTGGGATGGAGCGCGCCGTTTTCACTAATCGAATTGAACAAAT
GAGTATGGGGCAACGGAAAAAAGTCGAAGTAGCCAAATCATTGTCTCAATCAGCTGAACTTTATATTTGGGATGAACCCC
TTAATTACTTGGATGTGTTTAATCATCAACAATTAGAAGCGCTAATCTTATCTGTGAGGCCTGCAATGCTAGTGATTGAG
CATGATGCACATTTCATGAAGAAAATAACGGATAAAAAAATTGCCTTGAAATCATAA

>>MEG_3645|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|LSA
ATGTCGAAAATTGAACTAAAACAACTATCTTTTGCCTATGATAATCAAGAAGCGTTGCTTTTTGATCAGGCAAATATCAC
GATGGATACCAATTGGAAATTAGGATTGATTGGCCGCAATGGCCGTGGGAAAACAACCTTATTAAGATTGTTACAAAAGC
AGTTGGATTACCAAGGAGAGATTCTTCATCAAGTCGATTTCGTCTATTTTCCACAAACAGTTGCAGAAGAACAACAGCTC
ACTTATTATGTCTTACAAGAGGTGACTTCTTTTGAACAGTGGGAATTAGAACGAGAATTAACGCTTTTAAACGTTGATCC
TGAAGTTTTATGGCGGCCCTTTTCTTCTTTATCAGGCGGCGAAAAGACGAAAGTTTTATTAGGTCTTCTTTTTATTGAAG
AAAAGGCCTTTCCTTTAATTGACGAGCCAACAAATCATTTAGATCTAGCTGGCAGACAACAAGTGGCTGAATATTTGAAG
AAAAAGAAACACGGGTTTATTTTAGTCAGCCACGATCGGGCATTTGTTGATGAAGTGGTTGATCATATTTTGGCGATTGA
AAAAAGTCAATTGACGCTGTATCAAGGGAATTTTTCTATTTATGAAGAGCAAAAAAAATTAAGAGATGCTTTTGAACTAG
CAGAAAATGAAAAAATCAAAAAAGAAGTCAATCGCTTGAAAGAAACCGCTCGTAAAAAAGCGGAATGGTCGATGAACCGT
GAAGGTGATAAGTACGGCAATGCTAAAGAAAAAGGAAGCGGGGCGATTTTTGATACAGGAGCCATTGGTGCCCGGGCAAC
GCGCGTAATGAAGCGCTCGAAACACATTCAACAACGTGCCGAAACACAATTAGCAGAAAAAGAAAAACTATTAAAAGATC
TTGAGTATATTGATCCTTTGTCAATGGATTATCAGCCAACGCATCACAAAACATTATTGACGGTGGAAGAGCTTCGTCTA
GGCTACGAGAAAAATTGGCTGTTTGCGCCAATTTCTTTTTCAATAAACGCGGGAGAAATTGTTGGAATAACAGGAAAAAA
TGGCTCAGGAAAATCGAGCTTGATTCAGTATTTGTTGGGGGATTTTTCTGGAGATTCAGAAGGCGAAGCCACTTTGGCTC
ACCAATTAACCATTTCTTATGTGCGCCAAGATTATGAAGACAATCAAGGAACTTTATCCGAATTTGCAGAGAAAAATCAG
TTAGATTACACCCAATTTTTAAATAACTTACGAAAACTTGGGATGGAGCGCGCCGTTTTCACTAATCGAATTGAACAAAT
GAGTATGGGGCAACGGAAAAAAGTCGAAGTAGCCAAATCATTGTCTCAATCAGCTGAACTTTATATTTGGGATGAACCCC
TTAATTACTTGGATGTGTTTAATCATCAACAATTAGAAGCGCTAATCTTATCTGTGAAGCCTGCAATGCTAGTGATTGAG
CATGATGCACATTTCATGAAGAAAATAACAGATAAAAAAATTGTCTTGAAATCATAA