MEGAResFrom MEG, the Microbial Ecology Group

MPRF

The mprF gene encodes a bacterial defensin resistance protein. Mutations in this gene have been linked to daptomycin resistance and multi-drug resistance.

References

Sequences

Download Sequences

>Amp|HM140977.1|gene1|Lipopeptides|Phosphotidylglycerol_lysyltransferase|MPRF|RequiresSNPConfirmation
ATGAATCAGGAAGTTAAAAACAAAATATTTTCAATCTTAAAAATTACGTTTGCTACAGCTTTATTTATTTTTGTAGCAAT
CACATTGTATCGGGAGTTATCTGGTATTAACTTTAAAGATACGTTGGTTGAATTTAGTAAGATTAACCGTATGTCCTTAG
TGTTACTATTTATTGGTGGTGGGGCATCGCTTGTTATTCTATCAATGTATGATGTGATTTTATCTAGAGCTTTAAAAATG
GATATATCCTTAGGCAAAGTTTTAAGAGTAAGTTATATCATCAATGCATTGAATGCGATTGTAGGTTTCGGTGGCTTTAT
TGGTGCAGGCGTTAGAGCAATGGTTTATAAAAACTATACGCATGATAAAAAGAAATTAGTTCACTTTATATCCTTAATAC
TTATTTCAATGTTGACAGGTTTAAGCTTATTATCATTGCTAATTGTATTCCATGTTTTCGATGCATCTTTAATCTTAGAT
AAGATTACATGGGTAAGATGGGTATTATATGTAGTGTCATTTTTCTTACCATTATTCATTATTTATTCAATGGTTAGACC
ACCCGATAAAAACAATCGTTTTGTAGGATTGTACTGCACTTTAGTGTCGTGTGTTGAATGGTTAGCAGCTGCAGTTGTAT
TATATTTCTGTGGTGTAATTGTTGACGCTCATGTATCATTCATGTCCTTTATTGCAATATTTATCATTGCTGCATTATCA
GGTTTAGTCAGCTTTATTCCTGGTGGTTTCGGCGCTTTCGATTTAGTTGTATTACTAGGATTTAAAACTTTAGGTGTCCC
TGAGGAAAAAGTATTATTAATGCTACTTCTATATCGTTTTGCGTACTATTTTGTACCGGTAATTATTGCATTAATTTTAT
CATCATTTGAATTTGGTACATCAGCTAAGAAGTACATTGAGGGATCTAAATACTTTATTCCTGCTAAAGATGTTACGTCA
TTTTTAATGTCTTATCAAAAGGATATTATTGCTAAAATTCCATCATTATCATTAGCAATTTTAGTATTCTTTACAAGTAT
GATCAACTTAACGATTGTTTACGATGCTTTATATGATGGAAATCACTTAACGTATTATATTCTATTGGCAATTCATACTA
GTGCTTGTTTATTACTTTTACTGAATGTAGTTGGTATTTATAAGCAAAGTAGACGTGCCATTATCTTTGCTATGATTTCA
ATTTTATTAATCACAGTGGCGACATTCTTCACTTACGCTTCATATATTTTAATAACATGGTTAGCTATTATTTTTGTTCT
GCTTATTGTAGCTTTCCGTAGAGCACGTAGGTTGAAACGCCCAGTAAGAATGAGAAATATAGTTGCAATGCTTTTATTCA
GTTTATTTATTTTATATGTTAACCATATATTTATTGCTGGAACGTTATATGCATTAGATATTTATACGATTGAAATGCAT
ACATCTGTATTGCGCTATTACTTCTGGCTTACGATTTTAATCATCGCTATCATCATAGGTATGATTGCATGGTTGTTTGA
TTATCAATTTAGCAAAGTACGTATTTCTTCTAAAATTGAAGATTGCGAGGAGATTATTAATCAGTACGGCGGTAATTATT
TGAGTCACTTGATATATAGTGGTGACAAGCAGTTTTTCACTAATGAAAATAAAACAGCATTTTTAATGTATCGTTATAAA
GCAAGTTCATTAGTGGTTCTTGGAGATCCGTTAGGTGATGAAAATGCCTTTGATGAATTGTTAGAAGCATTCTATAATTA
CGCTGAGTATTTAGGCTATGATGTTATATTCTATCAAGTTACAGATCAACACATGCCTTTATATCATAATTTCGGTAACC
AATTTTTCAAATTAGGTGAAGAAGCAATTATTGATTTAACGCAATTTTCAACTTCAGGTAAAAAACGCCGTGGATTTAGA
GCGACTTTAAATAAATTCGATGAACTTAATATTTCGTTCGAAATTATTGAACCACCGTTTTCAACTGAATTTATAAATGA
ACTTCAACATGTAAGTGATTTATGGCTAGATAATCGTCAGGAAATGCATTTCTCTGTTGGTGAATTTAATGAAGAATACT
TATCTAAAGCGCCAATTGGTGTAATGCGAAATGAAGAAAATGAAGTAATTGCATTTTGTAGTTTAATGCCAACATACTTT
AATGATGCCATTTCAGTCGATTTAATTAGATGGTTGCCAGAGTTAGATTTACCATTAATGGATGGTCTATACTTGCATAT
GTTACTTTGGAGTAAAGAACAAGGTTATACAAAATTTAATATGGGTATGGCAACGTTATCGAACGTTGGTCAATTGCATT
ATTCATATTTAAGAGAACGACTTGCAGGCCGTGTCTTTGAACATTTCAACGGTCTATATCGTTTCCAAGGATTACGTCGT
TATAAATCTAAATATAATCCGAATTGGGAACCACGCTTTTTAGTTTATCGTAAAGATAATTCGCTTTGGGAATCACTTTC
TAAAGTAATGCGTGTAATACGTCACAAATAA

>CARD|pvgb|AL009126|916777-919348|ARO:3003324|Bacillus|Lipopeptides|Phosphotidylglycerol_lysyltransferase|MPRF|RequiresSNPConfirmation
TTGCTGATTAAAAAGAATGCTTTATCAATATTAAAAATCGTTTTTCCTATTGCTGTTTTGCTATTTGTTATTTATCAATC
GAAAAAAGAACTGACAAATCTGTCATTCAAACGTACGCTCATGGTCATCAACGGACTGGAACGAACGGATTTATTCATGC
TTGTGTTGATCGGCTTGCTGGCTGTTGCGGCTATGTCGCTGTATGATTACGTCCTGAAGTACTCACTGCGCCTATCGATC
ACAAACGGAAAAGTTTTCAGGGTTTCCTGGATCGCCAATTCATTTAATAATGTGTTGGGATTCGGCGGTTTAGCCGGAGT
CGGGTTAAGAATGATGTTCTATAAGGAGCATACGAAAGACCATAAGGCACTCGTGAAAGGAATCGCCTGGCTCACATCAT
CTATGCTGCTCGGATTATCTGTTTTCAGCATTTTCGTTGCTGCGAGAGTGCTGCCAGTTGATGAAGTGATTCATGAGAAG
CCTTGGCTGTGGGCGGTCGTTATCGGTTTTGCACTGATATTGCCGTTATCTTTAGCGGTGTCCAAAATAAAAGACCGCAA
AGCTGGGGACGAAGAGAATGCGGATAAAGTGAAAAATCCGATTTTCGCATATATTGGAGCTTCAGTTGTTGAATGGCTCA
TGGCCGGGACCGTCATCTATTTTGCTTTGTTCGCTATGGGCATTCATGCAGATATCAGGTATGTGTTCGGGGTGTTCGTC
ATTGCGGCGATCGGAGGAATGATCAGCCTCGTGCCGGGCGGCTTCGGCTCGTTTGACCTTTTATTTTTGCTGGGGATGGA
GCAGCTTGGCTATCATCAAGAGGCCATCGTTACTTCTATTGTGTTGTACAGGCTCGCCTACTCATTTATCCCATTTATCT
TGGGACTGTTCTTTGCCGCCGGCGACCTGACGGAAAATACAATGAAGCGGCTCGAAACGAACCCGCGCATCGCACCGGCA
ATTGAGACGACAAACGTTCTGCTTGTTGTTCAGCGTGCGGTATTAGTGAGAATTTTGCAAGGCTCGCTTTCCCTTATTGT
GTTCGTAGCAGGTCTGATTGTCTTGGCCTCAGTTTCCTTGCCGATTGACAGGCTGACGGTTATACCGCACATTCCGCGCC
CGGCGCTTTTGCTGTTCAACGGCCTGTCCTTAAGCTCAGCGCTCATTCTGCTCATTTTGCCGATCGAGCTTTATAAACGG
ACAAAACGTTCCTACACGATGGCCATTACAGCGCTTGTCGGCGGCTTTGTGTTCAGCTTTTTAAAAGGGCTTAACATCAG
CGCGATATTCGTACTGCCGATGATTATCGTATTGCTTGTGCTATTGAAAAAACAATTTGTCCGCGAACAGGCATCCTATA
CACTGGGACAATTGATATTCGCTGTGGCGCTGTTTACTGTGGCGCTCTTTAACTACAATCTGATCGCGGGCTTTATTTGG
GACCGGATGAAGAAGGTGCTGCGTCACGAATATTTCGTCCACAGCACCTCGCATATTACACATGCAACCATCATGGCGAT
CATCATTGTGCCGCTGTTCTTCTTGATATTTACAGTGGTCTATCATAAGAGAACGAAACCGATCGGAGAGAAAGCTGACC
CTGAGCGTCTTGCTGCGTTTCTCAATGAAAAAGGCGGCAACGCGCTGAGCCATCTTGGTTTTCTTGGAGATAAGCGGTTT
TATTTTTCTAGCGATGGAAATGCACTGCTTCTGTTTGGGAAAATCGCCAGAAGGCTGGTCGTGCTCGGCGATCCATCTGG
CCAAAGAGAATCATTCCCGCTCGTGCTGGAAGAATTTCTGAACGAAGCGCATCAGAAGGGATTCAGTGTTTTGTTCTATC
AAATTGAACGAGAGGACATGGCGCTGTATCACGATTTTGGCTACAACTTCTTTAAATTGGGTGAGGAAGCATATGTAGAT
TTAAATACATTTACCTTGACTGGGAAGAAAAAAGCCGGCCTTCGGGCAATCAATAACCGCTTTGAGCGGGAGGAGTATAC
TTTCCATGTGGATCATCCCCCATTTTCTGATGCGTTTTTGGAGGAGCTGAAGCAAATCTCAGACGAATGGCTCGGCTCGA
AAAAAGAGAAGGGATTCTCGCTCGGATTTTTTGATCCTTCCTATTTACAGAAAGCGCCGATCGCCTATATGAAAAATGCA
GAAGGAGAGATCGTTGCATTCGCAAATGTCATGCCGATGTACCAGGAAGGAGAGATATCGGTCGATCTGATGCGCTATCG
CGGCGACGCTCCAAATGGCATTATGGACGCATTGTTTATCCGTATGTTTTTATGGGCAAAGGAAGAGGGCTGTACGTCAT
TTAATATGGGGATGGCACCCTTGGCCAATGTCGGCACTGCCTTTACATCCTTCTGGTCCGAAAGGTTTGCCGCTGTCATT
TTTAATAATGTCAGATACATGTACAGTTTCAGCGGCCTAAGAGCCTTTAAAGAAAAATATAAACCGGAGTGGCGAGGGAA
ATACTTAGCGTATCGGAAAAACAGATCTCTTTCTGTCACCATGTTCCTCGTTACACGTCTGATTGGCAAAAGCAAAAAAG
ACTCCGTCTAA

>CARD|pvgb|NC_002952|1427046-1429569|ARO:3003319|Staphylococcus|Lipopeptides|Phosphotidylglycerol_lysyltransferase|MPRF|RequiresSNPConfirmation
ATGAATCAGGAAGTTAAAAACAAAATATTTTCAATCTTAAAAATTACGTTTGCTACAGCTTTATTTATTTTTGTAGTAAT
CACGTTGTATCGAGAGTTATCTGGGATTAACTTTAAAGATACTTTGGTTGAATTTAGTAAAATCAACCGTATGTCCCTTG
TCTTATTATTTATTGGTGGTGGGGCATCGCTTGTTATTCTCTCAATGTATGATGTGATTTTATCTAGAGCTTTAAAAATG
GATATTTCATTAGGAAAAGTTTTAAGAGTAAGTTATATCATTAATGCATTAAATGCGATTGTAGGCTTTGGTGGCTTTAT
TGGTGCCGGTGTAAGAGCAATGGTTTACAAAAACTATACGCATGATAAAAAGAAATTGGTTCACTTTATTTCATTAATAC
TGATTTCAATGTTGACAGGTTTAAGTTTGTTATCATTGTTAATCGTATTCCATGTTTTTGATGCATCATTAATTTTAAAT
AAAATTACGTGGGTGAGATGGGTACTTTATGCTGTGTCGTTGTTCTTACCATTATTTATTATATATTCAATGGTTAGACC
GCCCGATAAAAACAATCGTTATGTAGGCTTGTATTGTACATTAGTGTCATGTGTGGAATGGTTAGCCGCTGCAGTTGTAT
TATACTTCTGTGGTGTCATAGTTGACGTCCATGTCTCATTTATGTCATTTATTGCAATATTCATTATTGCTGCATTATCT
GGATTAGTCAGCTTTATTCCAGGTGGTTTTGGTGCCTTCGACTTAGTTGTTTTATTAGGCTTTAAAACGTTAGGTGTACC
TGAAGAAAAAGTATTATTAATGCTACTACTTTATCGCTTTGCGTACTATTTCGTACCAGTGATTATTGCATTAATCCTTT
CATCATTTGAGTTTGGTACTTCAGCTAAGAAATATATTGAAGGATCTAAATATTTCATTCCGGCTAAAGATGTGACATCG
TTTTTAATGTCGTATCAAAAAGATATTATTGCTAAAATACCATCATTATCATTGGCAATTTTAGTATTCTTTACAAGTAT
GATTTTCTTTGTAAATAATTTGACGATTGTATACGATGCTTTATATGATGGCAATCATTTAACGTATTATCTTTTATTGG
CAATACATACAAGTGCCTGTTTATTACTTTTACTTAATGTTGTAGGTATTTATAAACAAAGTAGACGTGCCATTATTTAT
GCAATGATTTCGATTATCTTAATTATTGTCGCGACGTTATTCACTTATGCGTCATACATTTTAATAACTTGGTTAGTTAT
TATCTTTGCTTTACTTATTGTTGCTTTCCGTAGAGCACGTAGGTTAAAACGTCCAATTCGAATGAGAAATCTAGTCGCAA
TGCTTTTGTTCAGCATATTTATACTCTACATCAACCATATATTTATAGCTGGAACATTTTATGCTTTAGATGTTTATACA
ATCGAAATGCATACGTCTGTACTTAAATATTATTTCTGGATTACCATTTTAATTATCGCAATTATTGTTGGTGCAATTGC
GTGGTTATTCGATTATCAATTTAGTAAAGTGCGTATATCTTCTAATATTGAAGAGTGCGAAGAGATTATTGATCAATATG
GTGGGAATTATTTAAGTCATTTAATTTATAGTGGTGATAAACAGTTCTTTACTAATGAAGATAAAAATGCATTTTTAATG
TATCGCTATAAAGCAAGTTCGTTAGTAGTTCTTGGCGATCCAATCGGTGATGAAAATGCCTTTGATGAATTGTTAGAAGC
ATTCTATAATTACGCTGAGTATTTAGGCTATGATGTTATATTCTATCAAGTTACAGATCAACACATGCCTTTATATCATA
ATTTCGGCAACCAATTTTTCAAATTAGGTGAAGAAGCAATTATTGATTTAACGCAATTTTCAACTTCAGGTAAAAAACGC
CGTGGATTTAGAGCGACTTTAAACAAATTCGATGAACTTAATATTTCATTCGAAATTATTGAACCACCGTTTTCAACTGA
ATTTATAAATGAACTTCAACATGTCAGTGATTTGTGGTTAGATAATCGTCAGGAAATGCATTTCTCTGTTGGTCAATTTA
ATGAAACATATTTATCTAAAGCGCCAATTGGTGTGATGCGCAATGAAAATAATGAAGTAATTGCATTTTGTAGTTTAATG
CCAACATACTTTAATGATGCCATTTCAGTCGATTTAATTAGATGGTTGCCAGAGTTAGATTTACCGTTAATGGATGGATT
ATACTTGCACATGTTACTTTGGAGTAAAGAACAAGGTTATACAAAATTTAATATGGGTATGGCAACGTTATCGAACGTTG
GTCAATTGCATTATTCATATTTAAGAGAAAGACTTGCAGGTCGTGTCTTTGAACATTTCAACGGTCTATATCGTTTCCAA
GGATTACGTCGTTATAAATCTAAATATAATCCGAATTGGGAACCACGCTTTTTAGTTTATCGTAAAGATAATTCGCTTTG
GGAATCACTTTCTAAAGTAATGCGTGTAATACGTCACAAATAAT