MEGAResFrom MEG, the Microbial Ecology Group

PGSA

The pgsA gene encodes CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase, which participates in the synthesis of components of the phospholipid bilayer. Mutations in this gene have been linked to daptomycin resistance.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/22238576

Other Groups in Daptomycin-resistant mutant

Sequences

Download Sequences

>>MEG_5779|Drugs|Lipopeptides|Daptomycin-resistant_mutant|PGSA|RequiresSNPConfirmation
ATGAAAAAAGAACTGAGCTTTCATGAAAAGCTGCTAAAGCTGACAAAACAGCAAAAAAAGAAAACCAATAAGCACGTATT
TATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGT
ATTCTGACGACGTACTCTCAGCCTCATTTGTAGGCGATATTATGATGGGACGCTATGTTGAAAAAGTAACGGAGCAAAAA
GGGGCAGACAGTATTTTTCAATATGTTGAACCGATCTTTAGAGCCTCGGATTATGTAGCAGGAAACTTTGAAAACCCGGT
AACCTATCAAAAGAATTATAAACAAGCAGATAAAGAGATTCATCTGCAGACGAATAAGGAATCAGTGAAAGTCTTGAAGG
ATATGAATTTCACGGTTCTCAACAGCGCCAACAACCACGCAATGGATTACGGCGTTCAGGGCATGAAAGATACGCTTGGA
GAATTTGCGAAGCAAAATCTTGATATCGTTGGAGCGGGATACAGCTTAAGTGATGCGAAAAAGAAAATTTCGTACCAGAA
AGTCAACGGGGTAACGATTGCGACGCTTGGCTTTACCGATGTGTCCGGGAAAGGTTTCGCGGCTAAAAAGAATACGCCGG
GCGTGCTGCCCGCAGATCCTGAAATCTTCATCCCTATGATTTCAGAAGCGAAAAAACATGCTGACATTGTTGTTGTGCAG
TCACACTGGGGCCAAGAGTATGACAATGATCCAAACGACCGCCAGCGCCAGCTTGCAAGAGCCATGTCTGATGCGGGAGC
TGACATCATCGTCGGCCATCATCCGCACGTCTTAGAACCGATTGAAGTATATAACGGAACCGTCATTTTCTACAGCCTCG
GCAACTTTGTCTTTGACCAAGGCTGGACGAGAACAAGAGACAGTGCACTGGTTCAGTATCACCTGAAGAAAAATGGAACA
GGCCGCTTTGAAGTGACACCGATCGATATCCATGAAGCGACACCTGCACCTGTGAAAAAAGACAGCCTTAAACAGAAAAC
CATTATTCGCGAACTGACGAAAGACTCTAATTTCGCTTGGAAAGTAGAAGACGGAAAACTGACGTTTGATATTGATCATA
GTGACAAACTAAAATCTAAATAA

>>MEG_5780|Drugs|Lipopeptides|Daptomycin-resistant_mutant|PGSA|RequiresSNPConfirmation
ATGAATATTCCGAACCAGATTACGGTTTTTAGAGTAGTGTTAATACCAGTTTTTATATTGTTTGCGTTAGTTGATTTTGG
ATTTGGCAATGTGTCATTTCTAGGAGGATATGAAATAAGAATTGAGTTATTAATCAGTGGTTTTATTTTTATATTGGCTT
CCCTTAGCGATTTTGTTGATGGTTATTTAGCTAGAAAATGGAATTTAGTTACAAATATGGGGAAATTTTTGGATCCATTA
GCGGATAAATTATTAGTTGCAAGTGCTTTAATTGTACTTGTGCAACTAGGACTAACAAATTCTGTAGTAGCAATCATTAT
TATTGCCAGAGAATTTGCCGTAACTGGTTTACGTTTACTACAAATTGAACAAGGATTCGTAAGTGCAGCTGGTCAATTAG
GTAAAATTAAAACAGCAGTTACTATGGTAGCAATTACTTGGTTGTTATTAGGTGATCCATTGGCAACATTGATTGGTTTG
TCATTAGGACAAATTTTATTATACATTGGCGTTATTTTTACTATCTTATCTGGTATTGAATACTTTTATAAAGGTAGAGA
TGTTTTTAAACAAAAATAA