MEGAResFrom MEG, the Microbial Ecology Group

CLS

The cls gene encodes cardiolipin synthetase. Mutations in this gene have been linked with resistance to daptomycin.

References

Sequences

Download Sequences

>CARD|pvgb|CP003583|1050805-1052287|ARO:3003092|Enterococcus|Lipopeptides|Daptomycin-resistant_cls|CLS|RequiresSNPConfirmation
TTATAGGATTGGAGAAAATAATCGAGAAATTTGTTGCTTGAATAATAGCCAGTTAGACATTTCCTTGACTGTTTCAGTTG
TCATGGATGAACAATGTGTCTCATCTTCTTTGAACTGAGTAGCAAGTTCTTCTAAAAACTCAGGATCGTAAATGACAGCA
CTTGTTTCAAAATTCAATCGGTAGCTACGAATATCTTGATTTGCTGAACCTACCATGCAGATTTCATCATCCATTATCAA
TGTTTTTGCATGGAGGAAGCCGTTCTCATAGACAAGGATTTGTACATTTTCCTTGATCAGCTGCCGAGCATAATATTGTG
TTGCTCGATAAATAAAAGGATGATCCGGTTTGTTGGGAATCATGATTTTCACATCTACACCAGAGGCAGTTGCGATTTTT
AAAGCAGCAATGACACTTTCATCAGGAACAAGGTAAGGTGTCTGTATCCAAACACGTTTTTTAGCAGAAGTAATCAATTT
GATAAATGAAAGCTTGATTTGTTCCCTTTCGTTATTCGGTCCGCTTGAAACAAGCTGGATGGATGTATCAGCAAGCTTAG
ATTCATCTCGATCTGCTTTTTTAAAGAAATAATTCAAATGATAGCCGACCTTTTTTTCTTCAGGTACCGAGACGTTCCAG
TCTGTTAAGAAGCGAAGCTGGAGCAAAGAAGAAGCGGCACCGAAAATCCGTATATGCGTATCGCGCCAATAGCCGAATTT
TTTTGTTGTATTTACATATTGATTGGCAATATTGAAACCACCGGTATAACTAATCTTTCCATCGATCACAACGATTTTTC
GGTGATCATGGTAATTCAATCGGAAACGAAGTAATGCCCTTTGTGAGGTAACAAATGTATGGACATGTCCACCATTTTTG
ATTAGACGATTGAAATCTTTTGCTTTTGTGCCATGAGAGCCAAATGCATCATATAATATTCGAACTTCCACGCCTTCTGC
GGCTTTTTCTTCTAAAACATGTAAGACTTGCTGGCCGATATTATCTGTCACAAATGCGTAATATTCGATATGGATCGAAT
GTTTGGCTTTTTTTAGATCTTGAAGCAGTGAATCCAATTTCTCTTGTCCGTCTGTGAGAAGAGTGACAGAATTCATTCTT
GTCAGCGGCATACGATTTAATGAAGAGAAGAAGTCAACAAATTGCTGTTTGTCTTTATCGCCCATGTCAGGATCGTAATG
TTCAATGGTATCTCCTCTAAAAGACTGAAAGTTTTCTAATTCTTTCAAGTCACTTTGTCGGAGATAGAATTTTTTCTTAT
CCGTTAATCCACGTCCGAAAAATAAATATAATACAAAGCCCACCCCAGGAAGGGCAAACAATACTAAGAGCCATGCCCAA
ATGGCTGCTACATCTCGGGGTTTGATCAAAATAGCCACCAAAGCAATAAGTGCATTTAATAGATAAAGGGCGGTTATAAT
ACTAGATACCACAAAAATGTTCCTCCTTACATACAATAACATT

>CARD|pvgb|NC_007795|2155375-2156860|ARO:3003074|Staphylococcus|Lipopeptides|Daptomycin-resistant_cls|CLS|RequiresSNPConfirmation
ATGATAGAGTTATTATCCATTGCACTCAAGCATTCTAATATTATTTTAAATTCAATATTTATTGGTGCATTTATTTTAAA
CTTATTATTCGCCTTTACCATTATTTTCATGGAAAGACGTTCTGCCAATTCTATCTGGGCTTGGTTACTAGTCTTAGTTT
TCTTGCCTTTATTCGGCTTCATTTTATACTTACTATTAGGACGACAAATTCAACGTGACCAAATTTTCAAAATTGATAAG
GAAGATAAAAAAGGATTAGAGTTAATCGTTGATGAGCAATTAGCTGCTTTAAAAAATGAAAACTTTTCAAATTCCAATTA
TCAAATTGTAAAATTTAAAGAAATGATTCAAATGTTGTTATATAATAACGCAGCATTTTTAACAACAGACAACGATTTAA
AAATATACACAGACGGCCAAGAAAAATTTGATGACCTAATACAAGACATCCGTAATGCTACTGATTATATTCATTTTCAG
TACTATATTATTCAAAATGATGAATTAGGTCGTACCATTTTAAATGAACTTGGTAAAAAAGCGGAACAAGGTGTAGAAGT
TAAAATTCTTTATGATGACATGGGTTCTCGTGGACTGCGTAAAAAAGGCTTACGCCCGTTTCGCAATAAAGGTGGACATG
CTGAAGCATTTTTCCCATCAAAATTACCTTTAATTAACTTGCGTATGAACAATCGAAACCATCGAAAAATTGTTGTAATA
GATGGGCAAATTGGATATGTTGGTGGTTTTAATGTTGGTGATGAGTACTTAGGTAAATCAAAAAAATTCGGCTATTGGCG
AGATACGCATTTACGAATTGTCGGGGATGCAGTGAATGCATTGCAATTACGATTTATTCTAGATTGGAATTCACAAGCCA
CACGTGACCACATCTCCTATGATGATCGTTATTTCCCAGATGTAAATTCTGGTGGAACAATTGGCGTTCAAATAGCTTCT
AGTGGTCCTGACGAAGAATGGGAACAGATTAAATACGGCTATTTGAAAATGATTTCATCTGCTAAAAAATCGATTTATAT
TCAATCTCCCTATTTCATACCTGATCAAGCCTTTTTAGATTCTATTAAAATTGCGGCATTAGGTGGTGTTGATGTCAATA
TCATGATTCCTAATAAACCTGACCATCCGTTTGTTTTTTGGGCTACTTTAAAAAATGCAGCATCCTTATTAGATGCCGGT
GTTAAAGTATTTCACTACGACAATGGCTTTTTACACTCAAAAACACTTGTTATAGATGATGAAATTGCAAGTGTGGGAAC
AGCTAATATGGACCATCGCAGTTTCACATTGAATTTCGAAGTCAACGCTTTTATTTATGACCAACAAATTGCCAAAAAAT
TAAAACAAGCTTTTATAGATGATTTAGCAGTATCTTCTGAATTAACAAAAGCACGTTATGCTAAGCGAAGTCTTTGGATT
AAATTTAAAGAAGGTATTTCACAATTATTGTCACCTATCTTATAAA