MEGAResFrom MEG, the Microbial Ecology Group

VANSL

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanL operon and is a regulator gene.

References

Other Groups in VanL-type regulator

Sequences

Download Sequences

>CARD|phgb|EU250284|5415-6510|ARO:3002938|vanSL|Glycopeptides|VanL-type_regulator|VANSL
TTGAAAAGTAAGGCGGAAACTACAACTATAAAACAGATACTAATAAAATATTTAGTAACTATAGGTTTATCGATGCTTGC
CTATTTAGTATTTCTTCTAACAATACTTATTATAATGAGAAATTTTGTATGGGACGGCACGGAGCCTATCTATCGTGTCT
TGCACTTTTTTTATCGTCTTTTTAATTTTGAAGGGATATTGATTATCGGTGTGATACTTATCCTATTCGTTGTTACATTG
TTTTTTGTTATGAAGATAATTGGCTATTTAAAACAAATCATCGAGGCGACGAAACAATTGCTTGAAAAACCAGAACAGCG
TGTTAAGCTATCAAGTGGCCTGTTCGAATTACAAGAAGAAATGAACCAACTACGTGAAAAAAATAATGCTGACAATCGCG
CAGCTAAAGAAGCGGAAAAGAGAAAAAACGATTTGATTGTTTATTTAGCTCATGATTTACGTACGCCATTAACTAGCGTA
ATTGGGTATTTAACGCTGTTAAAAGAAGAACCGGAAATATCGGTTCAAACTAGAGCTAAGTATACGAACATCGCTTTGAG
TAAAGCTTTTCGCCTTGAAGAATTATTGAGTGAATTTTTTGATGTGACGAGATTTAATTTGACTAACTTAACAATAAATG
AAGAACTAGTAGATTTAAGTGTGATGTTAGAGCAAATCAGCTACGAATTTTTACCTATTTTGGAAGAAAAAAAACTTTCT
TGGAATCTACACGTCGAGAGTAATATAAAATCTCTTTTAGATCCAGGAAAAATGGAACGTGTTTTTGATAACTTGATGCG
AAATGCTATTAATTATAGCTTTGAAGATACAATAATTGATTTAAGTTTAGAAAAAAAAGAATCTCAAGCTATTTTTAAAA
TTACAAATAGGACCTATACAATCCCAAAAGAAAAATTAGAAAAAATATTCGAACCGTTTTACCGAATGGACACATCTAGA
AGTAGCAGTACAGGTGGAACTGGGCTTGGTCTACCGATTGTAAGGGAAATTATTGAAGCTTCCAAAGGAACTATAAACGT
TAGTAGTAGCAATAATGAAATGACTTTTATAATCTATTTACCATACATAGATTAAG