MEGAResFrom MEG, the Microbial Ecology Group

VANXF

The vanX gene encodes a dipeptidase. This gene is part of the VanF operon and is a core resistance gene.

References

Sequences

Download Sequences

>835|AF155139.2|AF155139|Glycopeptides|VanF-type_resistance_protein|VANXF
ATGGAAAAAGATTTTGTTTTTTTAGATGAAATATTGCATGGAGTTCGTTGGGACTCCAAATATGCCACATGGGACAATTT
CACTGGAAAACCGGTAGACGGATATGAAGTCAATCGCATAGCGGGGACATATGCTTTGGCTGTTGCGCTGCTGGAGGTAA
AGAAGCAGGCGGCTGCTCTAGGGTACGGCTTGCTCCTGTGGGATGGCTATCGTCCTCAACGTGCGGTAAACTGTTTCTTG
CATTGGTCTGCGCAGCCGGAAGACGGCCGCACAAAAGAAAGATATTATCCCAATATTGATCGGATCGAGATGGTTACAAA
GGGATATGTGGCTTCAAAATCAAGCCACAGTCGCGGAAGCGCGATTGACCTTACGCTTTATCGATTGGACACGGGTGCGC
TTGTCCCTATGGGGAGCGGCTTCGATTTTATGGATGAACGTTCACATCATACCTCAAAAGGAATTTCAAGTAACGAAGCG
CAAAATCGCCAGTTATTATGTTCTATTATGGAATACAGCGGATTTGAATCATATGTATATGAATGGTGGCACTACGTATT
AAGAAACGAACCATACCCCAGCAGCTATTTTGATTTTCCCATTGGCGGGAACCATCTAGACCCATTTTCCAACTTTTGTG
GGACAGTGCCACTTGATGCGTTGTCGCCCTAA