MEGAResFrom MEG, the Microbial Ecology Group

VANXD

The vanX gene encodes a dipeptidase. This gene is part of the VanD operon and is a core resistance gene.

References

Other Groups in VanD-type resistance protein

Sequences

Download Sequences

>1429|AY082011.1|AY082011|Glycopeptides|VanD-type_resistance_protein|VANXD
ATGGAAAAGAACTTTGTCTTTTTGGATGAAATGCTGCCGGGCATCCGGTGGGATGCCAAATATGCCACATGGGACAATTT
CACCGGGAAACCGGTAGACGGATACGAGGTAAACCGCATTGTGGGAACGAAAGAGCTTGGTGCCGCTTTACGTAAGGCAC
AGAAGGCGGCGGAGAAACTGGGATACGGTCTGCTCTTATGGGACGGCTACCGTCCCCAGTGTGCAGTGGACTGCTTTTTG
ACTTGGGCTTCCCTGCCGGAGAACAATCTGACGAAAAAGCGTTACTACCCAAATATCAAAAGGAACGAGATGATCACGAA
AGGGTATGTGGCTTCTCAGTCCAGCCACAGTCGCGGGAGCGCGATTGATCTCACGATTTTTCGTTTGGACACGGGTATGC
TTGTGCCAATGGGCGGAGATTTCGACTTTATGGATGTACGGTCGCATCATGCCGCCAGTGGTCTGAGCGAAGAGGAGGCC
GGAAACCGTGAGCGCCTGCGTGATATCATGGAGCGCAGCGGATTTGAAGCCTACCGATATGAATGGTGGCATTATGTCTT
GGCAGACGAGCCATACCCGGATACATATTTTGATTTTTGCATTGCCTAG

>1440|AY489045.1|AY489045|Glycopeptides|VanD-type_resistance_protein|VANXD
ATGAAAAAGAACTTTGCCTTTTTAGATGAAATGATTCCCGGAATCCGATGGGATGCTAAATATGCCACATGGGACAATTT
CACCGGGAAACCGGTAGACGGATACATGGTAAACCGTGTTATGGGAACGAAGGAGCTGGGAGTTGCTTTGCGTAAGGCTC
AGAAGATGGCGGAGAAACTGGGATATGGTTTGCTCTTATGGGACGGCTATCGCCCCCAGTGCGCAGTGGATTGTTTTCTG
AATTGGACTTCCCAACCGGAAGACAATCTGACGAAAAAGCGTTACTATCCAAATATCAAAAGGAATGAGATGGTTGCGAA
GGGGTATGTGGCCTCAAAATCCAGCCACAGCCGTGGAAGTACGGTTGACCTTACAATTTTTCATTTGAATAGCGGTATGC
TTGTTCCTATGGGTGGAGATTTTGACTATATGGATGAACGGTCACACCATACCGCAAGCGGTCTGAGCGAAGAAGAATCA
AAAAACCGGCAGTGTTTGCGTTATATCATGGAGAGCAGCGGATTTGAAGCCTATCGTTATGAATGGTGGCATTACGTCTT
GGTGGACGAGCCATACCCGGATACATATTTTGATTTTTGGATGGCCTAG

>Gly|VanX-D_2_AF175293|Glycopeptides|VanD-type_resistance_protein|VANXD
ATGAAAAAGAACTTTGCCTTTTTAGATGAAATGATTCCCGGAATCCGATGGGATGCTAAATATGCCACATGGGACAATTT
CACCGGGAAACCGGTAGACGGATACATGGTAAACCGTGTTATGGGAACGAAGGAGCTGGGAGTTGCTTTGCGTAAGGCTC
ACAAGATGGCGGAGAAACTGGGATATGGTTTGCTCTTATGGGACGGCTATCGCCCCCAGTGCGCAGTGGATTGTTTTCTG
AATTGGGCTTCCCAACCGGAAGACAATCTGACGAAAAAGCGTTACTATCCAAATATCAAAAGGAACGAGATGATCACGAA
AGGGTATGTGGCTTCACAATCCAGCCACAGCCGTGGAAGTACGGTTGACCTTACAATTTTTCATTTGAATAGTGGTATGC
TTGTTCCTATGGGTGGGGATTTCGACTTTATGGATGAACGGTCACACCATGCCGCAAGCGGTCTGAGCGAAGAGGAATCA
AAAAACCGGCAGTGCTTGCGTTATATCATGGAGAGCAGCGGATTTGAAGCCTATCGTTATGAATGGTGGCATTACGTCTT
GGCGGACGAGCCATACCCGGATACATATTTTGATTTTTGTATCGCCTGA