MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANXD

The vanX gene encodes a dipeptidase. This gene is part of the VanD operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanD-type resistance protein

Sequences

Download Sequences

>>MEG_7564|Drugs|Glycopeptides|VanD-type_resistance_protein|VANXD
atgaaaaagaactttgcctttttagatgaaatgattcccggaatccgatgggatgctaaatatgccacatgggacaattt
caccgggaaaccggtagacggatacatggtaaaccgtgttatgggaacgaaggagctgggagttgctttgcgtaaggctc
agaagatggcggagaaactgggatatggtttgctcttatgggacggctatcgcccccagtgcgcagtggattgttttctg
aattgggcttcccaaccggaagacaatctgacgaaaaagcgttactatccaaatatcaaaaggaatgagatggttgcgaa
ggggtatgtggcctcacaatccagccacagccgtggaagtacggttgaccttacaatttttcatttgaatagcggtatgc
ttgttcctatgggtggagattttgactttatggatgaacggtcacaccatgccgcaagcggtctgagcgaagaagaatca
aaaaaccggcagtgcttgcgttatatcatggagagtagcggatttgaagcctatcgttatgaatggtggcattacgtctt
ggcggacgagccatacccggatacatattttgatttttgcattgcctag

>>MEG_7565|Drugs|Glycopeptides|VanD-type_resistance_protein|VANXD
atgaaaaagaactttgcctttttagatgaaatgattcccgggatccgatgggatgccaaatatgccacctgggacaattt
caccgggaaaccggtagacggatacatggtaaaccgtgttatgggaacgaaggagctgggagttgctttgcgtaaggctc
agaagatggcggagaagctaggatatggtttgctcttatgggacggctatcgcccccagtgcgcagtgaattgttttctg
aattgggcttcccaaccggaagacaatctgacgaaaaagcgttactatccaaatatcaaaaggaatgagatggttgcgaa
ggggtatgtggcctcacaatccagccacagccgtggaagtacggttgaccttacaatttttcatttgaatagcggtatgc
ttgttcctatgggtggagattttgactttatggatgaacggtcacaccatgccgcaagcggtctgagcgaagaagaatca
aaaaaccggcagtgcttgcgttatatcatggagagtagcggatttgaagcctatcgttatgaatggtggcattacgtctt
ggcggacgagccatacccggatacatattttgatttttgcattgcctag

>>MEG_7566|Drugs|Glycopeptides|VanD-type_resistance_protein|VANXD
atgatgaaacagaattttatttttttagacgaagtgctgcctggtattcgttgggatgccaaatatgccacatgggataa
ttttacaggcaaaccggtggacggatatgaggtaaaccgtattgtaggaaccaaagagctgggagctgctttacgcaaag
ctcaaaaacttgccatgaaacagggatatgggctgctcttatgggatggttatcgccctcagcgtgccgtggattgtttt
ctgcattgggcgtcactaccggagaataatctaacgaaaaaccggtattaccctaatataaagcggaatgaaatggtgac
aaagggatatgtggcctcacagtccagccatagccgcggaggcgcagttgatctcacgattttttatttagataccggta
tgcttgttcctatgggcggagattttgattttatggatgaacggtcccatcatgctgcaagcggactgacggaggaagaa
tccagaaaccgggaatgtctgcgccatatcatgggaaggagcggctttgaagcctattgtaacgaatggtggcattatgt
cctggcagatgaaccatacccaaatacatatttcaatttttgcattgcatga

>>MEG_7567|Drugs|Glycopeptides|VanD-type_resistance_protein|VANXD
atgaaaaagaactttgcctttttagatgaaatgattcccgggatccgatgggatgccaaatatgccacatgggacaattt
caccgggaaaccggtagacggatacatggtaaaccgtgttatgggaacgaaggagttgggagttgctttgcgtaaggctc
agaagatggcggagaaactgggatatggtttgctcttatgggacggctatcgcccccagtgcgcagtgaattgttttctg
aattgggcttcccaaccggaagacaatctgacgaaaaagcgttactatccaaatatcaaaaggaacgagatggtcaccaa
agggtatgtggcttcccagtccagccacagccgcggaagtgcagttgaccttacgattttccgtttggatacggggatgc
ttgtgccaatgggcggagatttcgacttcatggatgtgcggtcacatcatgccgcaagcggtctgagcgaagaggaatca
aaaaaccggcagtgcttgcgttatatcatggaaagcagcggatttgaagcctatcgctatgaatggtggcattacgtctt
ggcggacgagccatacccggatacatactttgatttttgcattgcctag

>>MEG_7568|Drugs|Glycopeptides|VanD-type_resistance_protein|VANXD
ATGAAAAAGAACTTTGCCTTTTTAGATGAAATGATTCCCGGAATCCGATGGGATGCTAAATATGCCACATGGGACAATTT
CACCGGGAAACCGGTAGACGGATACATGGTAAACCGTGTTATGGGAACGAAGGAGCTGGGAGTTGCTTTGCGTAAGGCTC
AGAAGATGGCGGAGAAACTGGGATATGGTTTGCTCTTATGGGACGGCTATCGCCCCCAGTGCGCAGTGGATTGTTTTCTG
AATTGGACTTCCCAACCGGAAGACAATCTGACGAAAAAGCGTTACTATCCAAATATCAAAAGGAATGAGATGGTTGCGAA
GGGGTATGTGGCCTCAAAATCCAGCCACAGCCGTGGAAGTACGGTTGACCTTACAATTTTTCATTTGAATAGCGGTATGC
TTGTTCCTATGGGTGGAGATTTTGACTATATGGATGAACGGTCACACCATACCGCAAGCGGTCTGAGCGAAGAAGAATCA
AAAAACCGGCAGTGTTTGCGTTATATCATGGAGAGCAGCGGATTTGAAGCCTATCGTTATGAATGGTGGCATTACGTCTT
GGTGGACGAGCCATACCCGGATACATATTTTGATTTTTGGATGGCCTAG

>>MEG_7569|Drugs|Glycopeptides|VanD-type_resistance_protein|VANXD
ATGAAAAAGAACTTTGCCTTTTTAGATGAAATGATTCCCGGAATCCGATGGGATGCTAAATATGCCACATGGGACAATTT
CACCGGGAAACCGGTAGACGGATACATGGTAAACCGTGTTATGGGAACGAAGGAGCTGGGAGTTGCTTTGCGTAAGGCTC
ACAAGATGGCGGAGAAACTGGGATATGGTTTGCTCTTATGGGACGGCTATCGCCCCCAGTGCGCAGTGGATTGTTTTCTG
AATTGGGCTTCCCAACCGGAAGACAATCTGACGAAAAAGCGTTACTATCCAAATATCAAAAGGAACGAGATGATCACGAA
AGGGTATGTGGCTTCACAATCCAGCCACAGCCGTGGAAGTACGGTTGACCTTACAATTTTTCATTTGAATAGTGGTATGC
TTGTTCCTATGGGTGGGGATTTCGACTTTATGGATGAACGGTCACACCATGCCGCAAGCGGTCTGAGCGAAGAGGAATCA
AAAAACCGGCAGTGCTTGCGTTATATCATGGAGAGCAGCGGATTTGAAGCCTATCGTTATGAATGGTGGCATTACGTCTT
GGCGGACGAGCCATACCCGGATACATATTTTGATTTTTGTATCGCCTGA