MEGAResFrom MEG, the Microbial Ecology Group

VANHA

The vanH gene encodes a D-Lac dehydrogenase. This gene is part of the VanA operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanA-type resistance protein

Sequences

Download Sequences

>>MEG_7398|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
atgaaaaacatcggcattaccgtttatggatgtaatcaggatgaggcagatgcattccgtgctctttcgccacaatttgg
cattatgccctcgattattaacgccgacgtgtcggaagctaacgccatatccgcccctttaaatcaatgtatcagtgtgg
gacacaaatccgagatttccgcgtctattcttgttgcgctgaagagaggcggtgtgaaatatatctctacccgaagcatc
ggctgcaatcatatagatacaattgccgctaagagaatcggcatcactgtcggcaatgtggcgtattcgccggatagcgt
tgctgattttaccatgatgctgatgcttatggcagtacgcaacacgaaatctatcgtacggtctgtggaaaaacatgatt
tcaggctggacagcgttcgggggaaggtactgagcgagatgacagttggcgtggtgggaacaggtcagataggcaaagcg
gttattgagcggctgcgaggatttggatgtaaagtgttggcttatagtcacagcaaaagtatagaggtatactatgttcc
gtttgatgagttgttgcaaaatagcgatatcgttacccttcatgtgccgctccatacggatacgcactatatcatcggtc
acgaacaaatacagagaatgaagaaaggagcgtttattatcaatactagtcgcggtccacttgtagatacctatgcgttg
gttaaagcattagaaaacggaaaactgggcggtgccgcattggatgtattggagggagaagaagagtttttctactctga
ttgtacccaaagacccattgataatcaatttttacttaaacttcaaaaaatgcctaacgtgataatcacaccgcatacgg
cttattataccgagcaagcgttgcgtgataccgttgaaaaaaccattacaaactgtttggattttgaaaggagactggag
catgaatag

>>MEG_7399|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
CACATCGACGTGGAATACGCCGAGAGCATCGGCATCACCGTCGGTAACGTCGCCTACTCGCCGGACAGCGTCGCGGACTT
CACGCTGATGCTGATGCTGATGGTGATACGCGACGCCAAATCCATCATCCGCCGCACGGAAGTCCATGACTACCGGCTGA
ACGCCGTACGCGGGAAAGAACTGCGCGACCTGACCGTCGGGGTGGTCGGAACAGGGCGCATCGGTGTCGCGGTCATGGAC
AGGTTGAAGGGCTTCGGCTGCCGGGTGCTGGCCTATGACACGATCCCCAACGCCTCCGCCGATTACGTCCCCCTCGACGA
TTTGCTGCAGCAGAGCGATATCGTGACACTTCACGTGCCACTCAACACGGACACGTATCACCTCCTCGATCGTCGGAACA
TCGAGGAGATGAAGGGTGGCGCGTACATCATCAACACCGGGCGCGGTCCACTCATCGAAACCGAGGCCCTCATCTCGGCC
CTGGAAAGCGGAAACCTCGGCGGAGCGGCGCTGGACGTCCTCGAAGGAGAGGAAGGCATCTTCTACGCCGACTGCCGGGA
CAAGGCAATCGACGGCAACAAGCCGTTGCTGCGGCTGCAGGAGCTGTCGAACGTGATCATCAGTCCGCATACCGCCTATT
ACACGGACCACGCTCTGAGCGACACTGTTGAAAACTCCATCATCAATTGCCTCGAATTCGAAAGCGGGAAGTAG

>>MEG_7400|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGACCTACAGCGAACCAGCGCGATCAGCTGCCCCCCGCACCGGATCGCCGGCGTCCGCCTCCTCCTCGGCCGTCTTGGC
GAGGGGAATCACGATTTATGGTTGCGGATCGGACGAGGCCGCCTTGTTCCGGGAGATGGCTCCTCGTTTCGGCGTAATGC
CGAACATTGTGGACGAGCCGGTATCCGAGGCGAATATCGGGCTGGTCTCCGGAAATCGATGCATCAGTATCGGTCACAAG
ACCAAGGTCACGAATTCCATTCTTCTCGCCCTCGCCGAAGCGGGCGTGGAATACATCTCCACCAGGAGCATCGGCTTCAA
CCACATCGATGTGGAATACGCGGCGAGCGTCGGTATCACCGTGGGCAATGTCGCCTACTCGCCCGACAGCGTCGCCGACT
TCACGCTGATGCTGATGCTGATGGCGGTGCGCGACGCCAAGTCCATCATCCGCCGCACCGAGGTGCACGACTACCGGCTG
AACGAGGTGCGCGGGAAAGAGCTGCGCGATCTGACCGTCGGAGTGGTCGGAACAGGGCGGATCGGGGTCGCGGTGCTGGA
CCGGCTGCGTGGTTTCGGCTGCCGGGTGCTGGCCTACGACACGCTGCTGACCGCCTCGGCCGATTACGTTCCGCTCGACG
AATTGCTCCAGCAGAGCGACATCGTGACGCTCCATGTGCCGCTCAACAACGATACCTATCATCTTCTCGACCGGAAGAAC
ATCGAGCGGATGAAGGACGGCGCGTACATCATCAACACCGGACGTGGCCCGCTCATCGAAACCGAAGCCCTCATTTCGGC
ACTGGAAGACGGCAAACTGGGCGGAGCGGCATTGGACGTCGTCGAAGGAGAGGAAGGCATCTTCTACGCCGACTGCCGGA
ACAAGCCGCTCGAGAGCGAAACGTTGCTGCGGCTGGAAAAGCTGCCGAACGTGCTCATCAGTCCGCATACCGCCTATTAC
ACGGACCACGCACTGAGTGACACTGTTGAAAACTCCATCATCAATTGTCTCCAATTCCGAAAGCGGGAAGTAGTATGGGT
AGGCTGA

>>MEG_7401|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGACCTACAGCGAACCAGCGCGATCAGCTGCCCCCCGCACCGGATCGCCGGCGTCCGCCTCCTCCTCGGCCGTCTTGGC
GAGGGGAATCACGATTTATGGTTGCGGATCGGACGAGGCCGCCTTGTTCCGGGAGATGGCTCCTCGTTTCGGCGTAATGC
CGACCATTGTGGACGAGCCGGTATCCGAGGCGAATATCGGGCTGGTCTCCGGAAATCGATGCATCAGTATCGGTCACAAG
ACCAAGGTCACGAATTCCATTCTTCTCGCCCTCGCCGAAGCGGGCGTGGAATACATCTCCACCAGGAGCATCGGCTTCAA
CCACATCGATGTGGAATACGCGGCGAGCGTCGGTATCACCGTGGGCAATGTCGCCTACTCGCCCGACAGCGTCGCCGACT
TCACGCTGATGCTGATGCTGATGGCGGTGCGCGACGCCAAGTCCATCATCCGCCGCACCGAGGTGCACGACTACCGGCTG
AACGAGGTGCGCGGGAAAGAGCTGCGCGATCTGACCGTCGGAGTGGTCGGAACAGGGCGGATCGGGGTCGCGGTGCTGGA
CCGGCTGCGTGGTTTCGGCTGCCGGGTGCTGGCCTACGACACGCTGCTGACCGCCTCGGCCGATTACGTTCCGCTCGACG
AATTGCTCCAGCAGAGCGACATCGTGACGCTCCATGTGCCGCTCAACAACGATACCTATCATCTTCTCGACCGGAAGAAC
ATCGAGCGGATGAAGGACGGCGCGTACATCATCAACACCGGACGTGGCCCGCTCATCGAAACCGAAGCCCTCATTTCGGC
ACTGGAAGACGGCAAACTGGGCGGAGCGGCATTGGACGTCGTCGAAGGAGAGGAAGGCATCTTCTACGCCGACTGCCGGA
ACAAGCCGCTCGAGAGCGAAACGTTGCTGCGGCTGGAAAAGCTGCCGAACGTGCTCATCAGTCCGCATACCGCCTATTAC
ACGGACCACGCACTGAGTGACACTGTTGAAAACTCCATCATCAATTGTCTCCAATTCGAAAGCGGGAAGTAG

>>MEG_7402|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAAAAACATCGGCATTACCGTTTATGGATGCGAGCAGGATGAGGCAGATGCATTCCGTGCCCTTTCGCCGCGCTTTGG
CATTATGCCCACGATAATTAACGCCGCCGTGTCAGAAGCCAACGCCATATCAGCCCCCTGCAATCAATGTATCAGCGTGG
GACACAAATCCGAGGTTTCCGCGTCTATTCTTCTTGCGCTGAAGAGAGCCGGCGTGAAATATATCTCTACCCGAAGCATC
GGCTGCAATCATATAGATACAACTGCCGCTAAGAGAATGGGCATCGCTGTCGGCAATGTGGCGTATTCGCCGGATAGCGT
TGCCGATTATACCATGATGCTGATGCTTATGGCAGTACGCAACGCCAAATCTATTGTGCGCTCTGTGGAAAAACATGATT
TCAGGCTGGACAGTGTCCGTGGCAAGGTACTGCGCGACATGACAGTCGGCGTGGTGGGAACCGGCCATATAGGCAAAGCG
GTTATTGAGCGGCTGCGGGGATTTGGATGTCATGTGCTGGCTTATGATCGCAGCCAAAAAATAGAGGCAAACTATGTTCC
GTTTGATGCGTTGTTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATGCGGATACGCGCCATATCATCGGCC
ACGAACAAATAAAGAGAATGAAGCAAGGCGCGTTTATTATCAATACTGGGCGCGGTCCACTTGTAGATACCGATGCGCTG
GTTAAAGCATTAGAAAACGGAAAACTGGGCGGTGCCGCATTGGATGTATTGGAGGGAGAGGAAGAGTTTTTCTACTCTGA
TTGCTCACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGAATGCCGAACGTGATAATCACGCCGCATACGG
CTTACTATACCGAACAGGCGTTGCGTGATACCGTTGAAAAAACAATTAAAAACTGTTTGGATTTTGAAAGGAGCCAGGAG
CATGAATAG

>>MEG_7403|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAATAACATCGGCATTACTGTTTATGGATGTGAGCAGGATGAGGCAGATGCATTCTGTGCCCTTTCGCCGCGTTTTGG
CGTTATGCCCTCGATAATTAACGCCAACGTGTCGGAATCCAACGCCAAATCCGCGCCTTTCAATCAATGTATCAGCGTGG
GACATAAATCAGAGGTGTCCGCGTCTATTCTTCTTGCGCTGAAGAGAGCCGGTGTGAAATATATCTCCACCCGAAGCATC
GGCTGCAATCATATAGATACAACTGCCGCTAAGAGAATGGGCATCACTGTCGGCAATGTGGCGTATTCGCCGGATAGCGT
TGCCGATTATACCATGATGCTGATGCTTATGGCAGTACGCAACGCTAAATCTATTGTCCGCTCTGTGGAAAAACATGATT
TCAGGTTGGACAGTGTCCGTGGCAAGGTACTGAGCGACATGACAGTCGGCGTGGTGGGAACGGGCCATATAGGCAAAGCA
GTTATTGAGCGGTTGCGGGGATTTGGATGTAAAGTGCTGGCTTATAGTCGCAGCCAAAGTATAGAGGCAAACTATGTTCC
GTTTGATGAGTTGTTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATGCGGATACGCGCCATATCATCAGCC
ACGAACAAATACAGAGAATGAAGCAAGGCGCGTTTATTATCAATACTGGCCGCGGTCCACTTGTATATACCAATGAGCTG
GTCAAAGCATTAGAAAACGGAAAACTGGGCGGTGCCGCATTGGATGTATTGGAAGGAGAGGAAGAGTTTTTCTACTCTGA
TTGCTCACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGAATGCCGAACGTGATAATCACGCCGCATACGG
CTTTTTATACCGAACAGGCGTTGCGTGATACCGTTGAAAAAACCAATATAAACTGTTTGGATTTTGAAAGGAGCCAGGAG
CATGAATAG

>>MEG_7404|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGCTGCCTACAATGTCCGCCATGACCTACAGCGAACCAGCGCGATCAGAGGCAAGTCGCTCCCGATCGCTGGCGTCCGC
GCCCTCCTCGGCCGACGAGGCAAGGGGAATCACGATTTATGGCTGCGGTCAGGACGAGGCCGTCCTCTTCAAGGAGATGG
CGCCTCGCTTCGGCATAATGCCGACCATCGCGGAAGCGCCGGTATCCGAAGCCACTATCGAATTGGCGTCAGGTAACCGA
TGCATCAGTGTCGGTCATAAGACTCCGATCTCGAACTCCATTCTCCTCGCGCTCCGTGAGGCGGGTGTGGAGTACATCTC
CACGAGGAGCATCGGGTTCAATCACATCGACGTGAAATACGCCGAGAGCATCGGCATCACCGTCGGTAACGTCGCCTACT
CGCCGGACAGCGTCGCGGACTTCACGCTGATGCTGATGCTGATGGTGATACGCGACGCCAAATCCATCATCCGCCGCACG
GAAGTCCATGACTACCGGCTGAACGCCGTACGCGGGAAAGAACTGCGCGACCTGACCGTCGGGGTGGTCGGAACAGGGCG
CATCGGTGTCGCGGTCATGGACAGGTTGAAGGGCTTCGGCTGCCGGGTGCTGGCCTATGACACGATCCCCAACGCCTCCG
CCGATTACGTCCCCCTCGACGATTTGCTGCAGCAGAGCGATATCGTGACACTTCACGTGCCACTCAACACGGACACGTAT
CACCTCCTCGATCGTCGGAACATCGAGGAGATGAAGGGTGGCGCGTACATCATCAACACCGGGCGCGGTCCACTCATCGA
AACCGAGGCCCTCATCTCGGCCCTGGAAAGCGGAAACCTCGGCGGAGCGGCGCTGGACGTCCTCGAAGGAGAGGAAGGGA
TCTTCTACGCCGACTGCCGGGACAAGGCAATCGACGGCAACAAGCCGTTGCTGCGGCTGCAGGAGCTGTCGAACGTGATC
ATCAGTCCGCATACCGCCTATTACACGGACCACGCTCTGAGCGACACTGTTGAAAACTCCATCATCAATTGCCTCGAATT
CGAAAGCGGGAAGTAG

>>MEG_7405|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGTCCTACAGAGACCTGGGTTTGATCGACAGCGAAGTGATCGCGGAGCGACGCGTCCGAGCGCTCGACGATTCGTCACC
CTCGGCCGTCCCGACCACTGGGGTCAGAGTTTTCGGATGCGGTCACGACGAAGCCGTTTTGTTCCGCGAGATGGGAACCC
GCCTCGGGATAACGCCAAGCATCACCGAGGAAGCGATCAGTGAAACCAACGCTGAACTGGCGCGTGGCAACCGATGCATC
AGCGTGAGCCACAAGACGCAGATCGACAATTCCACGCTGCTGGCGCTGAGCCGAGTCGGAGTGGAGTACATCTCCACCAG
AAGCGTCGGGTACAACCACATCGACGTGGAATTCGCGGCGAGCATCGGCATCTCGGTCGGCAACGTCGACTACTCGCCCG
ACAGCGTGGGCGACTACACACTGATGTTGATGCTGATGACCGTACGCCACGCGAAATCAATTGTCCGCCGCGCCGATACG
CATGATTACCGGCTGAATGACACGCGCGGCAGGGAGCTGCGCGACTTGACCGTCGGGGTGATCGGAACAGGGCGCATCGG
CACAGCAGTCATCGACCGGCTGCAGGGATTTGGCTGCCGCGTGCTGGCACATGACAGCGGGCCTCACGCCTCCGCCGACT
ACGTTCCGCTCGATGAACTGCTGCGGCAGAGCGACATTGTCACGCTCCACACTCCACTCACCGCGGACACACACCATCTC
CTCGATCGCCAACGCATCGACCAGATGAAGCACGGCGCGTACATCGTCAACACGGGTCGCGGACCGCTGCTCGATACCGA
GGCCCTCCTCTCCGCATTGGAGAGCGGCCGGTTGGGCGGCGCGGCGCTCGATGTCGTCGAAGGAGAGGAAGGGATCTTCT
ACGCCGACTGCAGGAACAGGCTCATCGAGAACAAGGCCCTGGTGCGGCTACAGCGCCTGCCGAATGTGCTGATCAGTCCG
CACTCCGCCTACTACACAGACCACGCCCTGAACGACACCGTCGAAAACAGCCTCGTCAACTGCCTGAACTTTGAAAGTGG
GAGAACAGCATGA

>>MEG_7406|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGACCTTCTCCTCGACCTCCTCGGCCCCTCCACCGTCACCGCTCCTCCCGGCAACGAGAATCACGGTTTACGGCTGCGG
GCGGGACGAGGCCGCCTTGTTCCGCCGGACGGCACCCCGTTTCGGCGTCGAGGCGACTCTCACGGAGGCCGCCGTATCCG
AAGAGAACGCCGAGATGGCGGCCGGAAACCAATGCATCAGCATTGACCACAAGACCCCGGTCACACCTGCCACTCTCCGC
GCTCTCCACCGGGCCGGCGTGACGTACATATCCACCCGGAGTATCGGTTACAACCACATCGATGTGACATACGCGGCCGG
CGTGGGGATATCCGTCGAGAACGTCACCTACTCCCCCGCCGGCGTGGCCGACTACACCCTGATGCTCATGCTGATGGCGG
TGCGCAACGCGAAATCCACCGTCCGCCGCGCGGAGCTGCACGACTACCGGCTGAACGAGATACGCGGTAAGGAGCTGCGC
GACCTGACCGTCGGAGTGATCGGGACGGGGCGTATCGGTGCGGCGGTCGTGGACAGGCTGCGGGGTTTTGGCTCCCGGGT
ACTGGCCTACGGAAAACGGCCCACCATCGCGGCAGATTACGTCTCTCTCGACGAGTTGCTGCGGTCGAGCGACATCGTGT
CGCTGCACGTACCGCTGACCCCGGACACGCATCACCTTCTCGATCAAAGCCGTATCCGGCGGATGAAAAGTGGCGCTTTC
GTCATCAACACCGGACGCGGCCCGCTCATCGACACCGAAGCGCTGGTACCGGCGTTGGAGAGCGGCAGGTTGAGCGGTGC
GGCGCTGGATGTCATCGAGGGCGAGGAAGGGATCTTCTACGCCGACTGCAGAAACAGAACCATCGAAAGCACGTGGCTCC
CGCGGCTGCAGAAAATGCCGAACGTACTCATCAGCCCGCACACCGCCTATTACACCGACCACGCCCTGATGGACACGGTC
GAGAACTCCATCATCAACTGCCTTAATTTCGGAAGCAGGAAACAGCATGGCTGA

>>MEG_7407|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAAAAACATCGGCATTACCATCTATGGATGTGAGCAGGATGAGGCTGATGTGTTCAAGGAACTTTCGCCGCGCTTTGG
CGTTATACCTGCCATTACAAGCTCTGCCGTATCAGAAACCAACGTAATGTTAGCCCCTGGAAATCAATGTATCAGCGTGG
GGCACAAATCTGAGATTTCCGAATCCATTCTTCTTGCGTTGAAGGAATCCGGCGTCAAATATATCTCTACTCGAAGTATT
GGTTACAATCACATAGACATGAAGGCCGCGGAAAGTATGGGTATTGCTGTCGGGAACGTGGCATATTCACCGGATAGCGT
TGCCGATTATACATTGATGCTGATGCTCATGGCAGTACGCAACGCGAAATCTATTGTGCGCTCTGTGGAAAAACATGATT
TCAAGCTGGACAGCGTCCGTGGCAAGGTACTGCGCGACATGACAGTCGGCGTGCTGGGAACCGGTCATATAGGCAAGAGG
GTTATTGAGCGACTGCGGGGATTTGGATGTCATGTGCTGGCGTATGGTCACAACAAAGAGGCGGCGGCAAATTATGTGTC
CCTCAATGAATTGCTGCAAAAAAGCGACATTCTTACCATTCACGTACCGCTTAGCGCGGACACATACCATATGATCGGTC
GCGAACAGATTAAAGCAATGAAACAGGGCGCGTTTCTTATCAATACAGCGCGAGGCGGGCTTATAGATACCGATGTGCTG
GTTAAAGCATTGGAAAACGGAAAACTGGGCGGCGCCGCATTGGATGTATTGGAGGGAGAGGAAGGACTTTTCTACTTTGA
TTGCACACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGGATGCCGAACGTGATAATCACGCCGCATACGG
CTTACTATACCGAACAGGCGTTGCGTGATACCGTTGAAAATACAATCAAGAACTGTCTGGAATTTGAGAGGAGAGAGACA
CTTGTATAG

>>MEG_7408|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAAAAACATCGGCATTACCATCTATGGATGTGAGCAGGATGAGGCTGATGTGTTCAAGGAACTTTCGCCGCGCTTTGG
CGTTATACCTGCCATTACAAGCTCTGCCGTATCAGAAACCAACGTAATGTTAGCCCCTGGAAATCAATGTATCAGCGTGG
GGCACAAATCTGAGATTTCCGAATCCATTCTTCTTGCGTTGAAGGAATCCGGCGTCAAATATATCTCTACTCGAAGTATT
GGTTACAATCACATAGACATGAAGGCCGCGGAAAGTATGGGTATTGCTGTCGGGAACGTGGCATATTCACCGGATAGCGT
TGCCGATTATACATTGATGCTGATGCTCATGGCAGTACGCAACGCGAAATCTATTGTGCGCTCTGTGGAAAAACATGATT
TCAAGCTGGACAGCGTCCGTGGCAAGGTACTGCGCGACATGACAGTCGGCGTGCTGGGAACCGGTCATATAGGCAAGAGG
GTTATTGAGCGACTGCGGGGATTTGGATGTCATGTGCTGGCGTATGGTCACAACAAAGAGGCGGCGGCAAATTATGTGTC
CCTCAATGAATTGCTGCAAAAAAGCGACATTCTTACCATTCACGTACCGCTTAGCGCGGACACATACCATATGATCGGTC
GCGAACAGATTAAAGCAATGAAACAGGGCGCGTTTCTTATCAATACAGCGCGAGGCGGGCTTATAGATACCGATGTGCTG
GTTAAAGCATTGGAAAACGGAAAACTGGGCGGCGCCGCATTGGATGTATTGGAGGGAGAGGAAGGACTTTTCTACTTTGA
TTGCACACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGGATGCCGAACGTGATAATCACGCCGCATACGG
CTTACTATACCGAACAGGCGTTGCGTGATACCGTTGAAAATACAATCAAGAACTGTCTGGAATTTGAGAGGAGAGAGACA
CTTGTATAGAGTAAAAATAGCCATCCTGTTTGGGGGCTGCTCAGAGGAACATGATGTGTCGGTAAAATCAGCGAAAGAGA
TTGCCAACAACATTAACACAGAAAAATATGAGCCAATATACATTGGAATAACCCGATCCGGCGTTTGGAAAATGTGCGAA
AAGCCATGCATGGATTGGGACAACGAAAACTGCCGTTCGGCAGTGCTTTCTCCGGACAAAAGAATGCACGGGCTGCTTGT
CATGCGGGATAAGGGATATCAAATACAGCGTATAGATGCGGCATTTTCGGTTTTGCACGGCAAATCGGGCGAAGACGGCG
CCATACAAGGTTTATTTGAATTGTCCGGCATCCCCTATGTAGGCTGTGATATTCAAAGCTCGGCGGTGTGTATGGACAAA
TCGCTGGCATACATCATTGCGAAAAACGATGGCATAGCTACTCCCGAATTTTGGGTTATTAATAAAGACGATAGGCCGGC
GGCAGCTGCGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTATGGCGTGAAAAAAGTCAATGGCG
CGGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGT
GAGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTAT
CTTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCGGCAG
AGGAGCGAGGACGGATACGGGATACGGCAAAAAAAATATATAAGGCGCTCGGCTGTAGAGGTCTTGCCCGTGTTGATATG
TTTTTACAAGATAACGGCCGCATTGTACTTAACGAAGTCAATACCCTGCCCGGTTTCACGTCATACAGCCGTTATCCCCG
TATGATGGTCGCTGCAGGTATAACGCTTCCCGAACTGATTGACCGCCTGATCGTATTAGCGTTAAAGGGGTGATAAGCAT
GGAAAAGGGATTTGTTTTTTTAGATGAAATATTGCACGGTGTTCGCTGGGACGCCAAATATGCCACATGGGACAATTTCA
CAGGGAAACCAGTAGACGGATATGAGGTCAATCGCATAGTGGGAACACATGCCTTAGCCCTTGCGCTGCTGAAGGCGCAG
AAGCAAGCGGCGGCTCTTGGGTACGGTTTGCTGTTATGGGACGGGTATCGGCCCAAACGTGCGGTAGATTGCTTCCTGCG
TTGGTCCGAACAACCGGAAGACAACCTCACAAAAGAAAGATACTATCCGAATATCGAGCGAACCGAGATGGTTTCAAAAG
GATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGCGCAATTGATCTTACGCTTTATCGATTAGACACGGGTGAGCTT
GTACCAATGGGGAGCGGATTTGATTTTATGGATGAGCGTTCACACCATGCGGCAAAAGGGATTGCAAGCATGGAAGCGCA
AAATCGCAGACGTTTGCGTTCCATCATGGAAAACAGTGGGTTTGAACCATATAGCTTCGAATGGTGGCACTATGTATTAA
GAAACGAAACCATACCCCAATAG

>>MEG_7409|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAAAAACATCGGCATTACCGTTTATGGATGCGAGCAGGATGAGGCAGATGCATTCCGTGCCCTTTCGCCGCGCTTTGG
CATTATGCCCACGATAATTAACGCCGCCGTGTCAGAAGCCAACGCCATATCAGCCCCCTGCAATCAATGTATCAGCGTGG
GACACAAATCCGAGGTTTCCGCGTCTATTCTTCTTGCGCTGAAGAGAGCCGGCGTGAAATATATCTCTACCCGAAGCATC
GGCTGCAATCATATAGATACAACTGCCGCTAAGAGAATGGGCATCGCTGTCGGCAATGTGGCGTATTCGCCGGATAGCGT
TGCCGATTATACCATGATGCTGATGCTTATGGCAGTACGCAACGCCAAATCTATTGTGCGCTCTGTGGAAAAACATGATT
TCAGGCTGGACAGTGTCCGTGGCAAGGTACTGCGCGACATGACAGTCGGCGTGGTGGGAACCGGCCATATAGGCAAAGCG
GTTATTGAGCGGCTGCGGGGATTTGGATGTCATGTGCTGGCTTATGATCGCAGCCAAAAAATAGAGGCAAACTATGTTCC
GTTTGATGCGTTGTTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATGCGGATACGCGCCATATCATCGGCC
ACGAACAAATAAAGAGAATGAAGCAAGGCGCGTTTATTATCAATACTGGGCGCGGTCCACTTGTAGATACCGATGCGCTG
GTTAAAGCATTAGAAAACGGAAAACTGGGCGGTGCCGCATTGGATGTATTGGAGGGAGAGGAAGAGTTTTTCTACTCTGA
TTGCTCACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGAATGCCGAACGTGATAATCACGCCGCATACGG
CTTACTATACCGAACAGGCGTTGCGTGATACCGTTGAAAAAACAATTAAAAACTGTTTGGATTTTGAAAGGAGCCAGGAG
CATGAATAGAGTAAAAGTTGCAATCCTGTTTGGGGGTTGCTCGGAGGAGCATGACGTTTCGGTTAAATCTGCAAGAGAGA
TTGCCGCTAACATTGACAACGAAAAATACGAGCCGTTATACATTGGAATTACGAAATTCGGTGTTTGGAAAATGTGCGAA
AAACCGTGCGCGGAATGGGAAAACAGCAATTGCTATTCAGCCGTACTCTCGCCGGATAAAAAAATGCACGGTTTGCTTGT
TAAAAAGAACCATGAATATGAAATCCACCACGTTGATGTAGCATTTTCGGTTTTGCACGGCAAGTCGGGTGAAGATGGAT
CAATACAAGGTCTGTTTGAATTGTCCGGTATCCCCTATGTGGGCTGCGATATTCAAAGCTCCGCGATTTGTATGGACAAA
TCGCTGACATACACAATTGCGAAAAACGCTGGCATAGCTACTCCTGATTTTTGGGTTATTAATAAAGACGATAAGCCGGC
GATAGATGCGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCTTATGGCGTGAAAAAAGTCAATGGCG
CAGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGT
GAGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTAT
CTTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCGGTAG
AGGTGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAGGCGCTCGGTTGTAGAGGTCTTTCCCGTGTTGATATG
TTTTTACAAGATAACGGCAGCATTGTACTTAACGAAGTCAATACCCTGCCTGGTTTCACGTCATACAGCCGTTATCCCCG
TATGATGGTCGCTGCAGGTATAACGCTTCCCGAACTGATTGACCGCCTGATCGTATTAGCATTAAAGGGATGATAAGAAT
GAAAATAGGATTTACTTTTTTAGATGAAATATTACACGGTGTTCGTTGGGACGCTAAATATGCCACATGGGACAATTTCA
CCGGAAAGCCGGTTGACGGATATGAAGTAAATCGCATTGTAGGAACATACGAGTTGGCCGACGCGCTTTTGAAGGTAAAA
GAACTGGCTGCTACTCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCCCAACGCGCTGTAAACTGTTTTTTGCA
ATGGGCTGCACAGCCGGAAGATGACCTGACAAAGGAAAGATATTATCCCAATATTGACCGAACCGAGATGGTTTCAAAAG
GATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGTGCAATTGATCTTACGCTTTATCGATTAGACACGGGTGAGCTG
GTACCAATGGGGAGCGGATTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAAAGGAATTTCAGGCAATGAAGCGCA
AAATCGCAGACGTTTGCGTTCCATCATGGAAGACAGTGGGTTTGAAGCATATAGCTTCGAATGGTGGCACTATGTATTAA
GAAACGAACCATACCCCAACAGCTATTTTGATTTCCCCGTTAAATAA

>>MEG_7410|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAATAACATCGGCATTACTGTTTATGGATGTGAGCAGGATGAGGCAGATGCATTCCATGCTCTTTCGCCTCGCTTTGG
CGTTATGGCAACGATAATTAACGCCAACGTGTCGGAATCCAACGCCAAATCCGCGCCTTTCAATCAATGTATCAGTGTGG
GACATAAATCAGAGATTTCCGCCTCTATTCTTCTTGCGCTGAAGAGAGCCGGTGTGAAATATATTTCTACCCGAAGCATC
GGCTGCAATCATATAGATACAACTGCTGCTAAGAGAATGGGCATCACTGTCGACAATGTGGCGTACTCGCCGGATAGCGT
TGCCGATTATACTATGATGCTAATTCTTATGGCAGTACGCAACGTAAAATCGATTGTGCGCTCTGTGGAAAAACATGATT
TCAGGTTGGACAGCGACCGTGGCAAGGTACTCAGCGACATGACAGTTGGTGTGGTGGGAACGGGCCAGATAGGCAAAGCG
GTTATTGAGCGGCTGCGAGGATTTGGATGTAAAGTGTTGGCTTATAGTCGCAGCCGAAGTATAGAGGTAAACTATGTACC
GTTTGATGAGTTGCTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATACGGATACGCACTATATTATCAGCC
ACGAACAAATACAGAGAATGAAGCAAGGAGCATTTCTTATCAATACTGGGCGCGGTCCACTTGTAGATACCTATGAGTTG
GTTAAAGCATTAGAAAACGGGAAACTGGGCGGTGCCGCATTGGATGTATTGGAAGGAGAGGAAGAGTTTTTCTACTCTGA
TTGCACCCAAAAACCAATTGATAATCAATTTTTACTTAAACTTCAAAGAATGCCTAACGTGATAATCACACCGCATACGG
CCTATTATACCGAGCAAGCGTTGCGTGATACCGTTGAAAAAACCATTAAAAACTGTTTGGATTTTGAAAGGAGACAGGAG
CATGAATAGAATAAAAGTTGCAATACTGTTTGGGGGTTGCTCAGAGGAGCATGACGTATCGGTAAAATCTGCAATAGAGA
TAGCCGCTAACATTAATAAAGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCTGGTGTATGGAAAATGTGCGAA
AAACCTTGCGCGGAATGGGAAAACGACAATTGCTATTCAGCTGTACTCTCGCCGGATAAAAAAATGCACGGATTACTTGT
TAAAAAGAACCATGAATATGAAATCAACCATGTTGATGTAGCATTTTCAGCTTTGCATGGCAAGTCAGGTGAAGATGGAT
CCATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTTTGTAGGCTGCGATATTCAAAGCTCAGCAATTTGTATGGACAAA
TCGTTGACATACATCGTTGCGAAAAATGCTGGGATAGCTACTCCCGCCTTTTGGGTTATTAATAAAGATGATAGGCCGGT
GGCAGCTACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTTCGGTGTGAAAAAAGTCAATAGCG
CGGACGAATTGGACTACGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTCGGGCTGT
GAGGTCGGTTGTGCGGTATTGGGAAACAGTGCCGCGTTAGTTGTTGGCGAGGTGGACCAAATCAGGCTGCAGTACGGAAT
CTTTCGTATTCATCAGGAAGTCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCGTTCCCGCAGACCTTTCAGCAG
AGGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAAGCGCTCGGCTGTAGAGGTCTAGCCCGTGTGGATATG
TTTTTACAAGATAACGGCCGCATTGTACTGAACGAAGTCAATACTCTGCCCGGTTTCACGTCATACAGTCGTTATCCCCG
TATGATGGCCGCTGCAGGTATTGCACTTCCCGAACTGATTGACCGCTTGATCGTATTAGCGTTAAAGGGGTGATAAGCAT
GGAAATAGGATTTACTTTTTTAGATGAAATAGTACACGGTGTTCGTTGGGACGCTAAATATGCCACTTGGGATAATTTCA
CCGGAAAACCGGTTGACGGTTATGAAGTAAATCGCATTGTAGGGACATACGAGTTGGCTGAATCGCTTTTGAAGGCAAAA
GAACTGGCTGCTACCCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCTAAGCGTGCTGTAAACTGTTTTATGCA
ATGGGCTGCACAGCCGGAAAATAACCTGACAAAGGAAAGTTATTATCCCAATATTGACCGAACTGAGATGATTTCAAAAG
GATACGTGGCTTCAAAATCAAGCCATAGCCGCGGCAGTGCCATTGATCTTACGCTTTATCGATTAGACACGGGTGAGCTT
GTACCAATGGGGAGCCGATTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAATGGAATATCATGCAATGAAGCGCA
AAATCGCAGACGTTTGCGCTCCATCATGGAAAACAGTGGGTTTGAAGCATATAGCCTCGAATGGTGGCACTATGTATTAA
GAGACGAACCATACCCCAATAGCTATTTTGATTTCCCCGTTAAATAA

>>MEG_7411|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAATAACATCGGCATTACTGTTTATGGATGTGAGCAGGATGAGGCAGATGCATTCCATGCTCTTTCGCCTCGCTTTGG
CGTTATGGCAACGATAATTAACGCCAACGTGTCGGAATCCAACGCCAAATCCGCGCCTTTCAATCAATGTATCAGTGTGG
GACATAAATCAGAGATTTCCGCCTCTATTCTTCTTGCGCTGAAGAGAGCCGGTGTGAAATATATTTCTACCCGAAGCATC
GGCTGCAATCATATAGATACAACTGCTGCTAAGAGAATGGGCATCACTGTCGACAATGTGGCGTACTCGCCGGATAGCGT
TGCCGATTATACTATGATGCTAATTCTTATGGCAGTACGCAACGTAAAATCGATTGTGCGCTCTGTGGAAAAACATGATT
TCAGGTTGGACAGCGACCGTGGCAAGGTACTCAGCGACATGACAGTTGGTGTGGTGGGAACGGGCCAGATAGGCAAAGCG
GTTATTGAGCGGCTGCGAGGATTTGGATGTAAAGTGTTGGCTTATAGTCGCAGCCGAAGTATAGAGGTAAACTATGTACC
GTTTGATGAGTTGCTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATACGGATACGCACTATATTATCAGCC
ACGAACAAATACAGAGAATGAAGCAAGGAGCATTTCTTATCAATACTGGGCGCGGTCCACTTGTAGATACCTATGAGTTG
GTTAAAGCATTAGAAAACGGGAAACTGGGCGGTGCCGCATTGGATGTATTGGAAGGAGAGGAAGAGTTTTTCTACTCTGA
TTGCACCCAAAAACCAATTGATAATCAATTTTTACTTAAACTTCAAAGAATGCCTAACGTGATAATCACACCGCATACGG
CCTATTATACCGAGCAAGCGTTGCGTGATACCGTTGAAAAAACCATTAAAAACTGTTTGGATTTTGAAAGGAGACAGGAG
CATGAATAGAATAAAAGTTGCAATACTGTTTGGGGGTTGCTCAGAGGAGCATGACGTATCGTTAAAATCTGCAATAGAGA
TAGCCGCTAACATTAATAAAGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCTGGTGTATGGAAAATGTGCGAA
AAACCTTGCGCGGAATGGGAAAACGACAATTGCTATTCAGCTGTACTCTCGCCGGATAAAAAAATGCACGGATTACTTGT
TAAAAAGAACCATGAATATGAAATCAACCATGTTGATGTAGCATTTTCAGCTTTGCATGGCAAGTCAGGTGAAGATGGAT
CCATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTTTGTAGGCTGCGATATTCAAAGCTCAGCAATTTGTATGGACAAA
TCGTTGACATACATCGTTGCGAAAAATGCTGGGATAGCTACTCCCGCCTTTTGGGTTATTAATAAAGATGATAGGCCGGT
GGCAGCTACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTTCGGTGTGAAAAAAGTCAATAGCG
CGGACGAATTGGACTACGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTCGGGCTGT
GAGGTCGGTTGTGCGGTATTGGGAAACAGTGCCGCGTTAGTTGTTGGCGAGGTGGACCAAATCAGGCTGCAGTACGGAAT
CTTTCGTATTCATCAGGAAGTCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCGTTCCCGCAGACCTTTCAGCAG
AGGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAAGCGCTCGGCTGTAGAGGTCTAGCCCGTGTGGATATG
TTTTTACAAGATAACGGCCGCATTGTACTGAACGAAGTCAATACTCTGCCCGGTTTCACGTCATACAGTCGTTATCCCCG
TATGATGGCCGCTGCAGGTATTGCACTTCCCGAACTGATTGACCGCTTGATCGTATTAGCGTTAAAGGGGTGATAAGCAT
GGAAATAGGATTTACTTTTTTAGATGAAATAGTACACGGTGTTCGTTGGGACGCTAAATATGCCACTTGGGATAATTTCA
CCGGAAAACCGGTTGACGGTTATGAAGTAAATCGCATTGTAGGGACATACGAGTTGGCTGAATCGCTTTTGAAGGCAAAA
GAACTGGCTGCTACCCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCTAAGCGTGCTGTAAACTGTTTTATGCA
ATGGGCTGCACAGCCGGAAAATAACCTGACAAAGGAAAGTTATTATCCCAATATTGACCGAACTGAGATGATTTCAAAAG
GATACGTGGCTTCAAAATCAAGCCATAGCCGCGGCAGTGCCATTGATCTTACGCTTTATCGATTAGACACGGGTGAGCTT
GTACCAATGGGGAGCCGATTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAATGGAATATCATGCAATGAAGCGCA
AAATCGCAGACGTTTGCGCTCCATCATGGAAAACAGTGGGTTTGAAGCATATAGCCTCGAATGGTGGCACTATGTATTAA
GAGACGAACCATACCCCAATAGCTATTTTGATTTCCCCGTTAAATAA

>>MEG_7412|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAATAACATCGGCATTACTGTTTATGGATGTGAGCAGGATGAGGCAGATGCATTCTGTGCCCTTTCGCCGCGTTTTGG
CGTTATGCCCTCGATAATTAACGCCAACGTGTCGGAATCCAACGCCAAATCCGCGCCTTTCAATCAATGTATCAGCGTGG
GACATAAATCAGAGGTGTCCGCGTCTATTCTTCTTGCGCTGAAGAGAGCCGGTGTGAAATATATCTCCACCCGAAGCATC
GGCTGCAATCATATAGATACAACTGCCGCTAAGAGAATGGGCATCACTGTCGGCAATGTGGCGTATTCGCCGGATAGCGT
TGCCGATTATACCATGATGCTGATGCTTATGGCAGTACGCAACGCTAAATCTATTGTCCGCTCTGTGGAAAAACATGATT
TCAGGTTGGACAGTGTCCGTGGCAAGGTACTGAGCGACATGACAGTCGGCGTGGTGGGAACGGGCCATATAGGCAAAGCA
GTTATTGAGCGGTTGCGGGGATTTGGATGTAAAGTGCTGGCTTATAGTCGCAGCCAAAGTATAGAGGCAAACTATGTTCC
GTTTGATGAGTTGTTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATGCGGATACGCGCCATATCATCAGCC
ACGAACAAATACAGAGAATGAAGCAAGGCGCGTTTATTATCAATACTGGCCGCGGTCCACTTGTATATACCAATGAGCTG
GTCAAAGCATTAGAAAACGGAAAACTGGGCGGTGCCGCATTGGATGTATTGGAAGGAGAGGAAGAGTTTTTCTACTCTGA
TTGCTCACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGAATGCCGAACGTGATAATCACGCCGCATACGG
CTTTTTATACCGAACAGGCGTTGCGTGATACCGTTGAAAAAACCAATATAAACTGTTTGGATTTTGAAAGGAGCCAGGAG
CATGAATAGAGTAAAAGTTGCAATCCTGTTTGGGGGTTGCTCCGAGGAGCATGACGTGTCGGTTAAATCTGCAAGAGAGA
TTGCCGCTAACATTGACAACGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCCGGTGTTTGGAAAATGTGCGAA
AAACCGTGCGCGGAATGGGAAAACAGCAATTGCTATTCAGCCGTACTCTCGCCGGATAAAAAAATGCACGGTTTGCTTGT
TAAAAAGAACCATGAATATGAAATCCACCACGTTGATGTAGCATTTTCGGGGATGCACAGCAAGTCAGGTGAAGATGGAT
CCATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTATGTGGGCTGCGATATTCAAAGCTCCGCGATTTGTATGGACAAA
TCGCTTACATACACAATTGCGAAAAACGCTGGCATAGCTATTCCTGAATTTTGGGTTATTAATAAAGACGATAAGCCGGC
GGCAGATACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCTTATGGCGTGAAAAAAGTCAATGTCG
CAGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGT
GAGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTAT
CTTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCAGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCAGCAG
AGGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAGGCGCTCGGTTGCAGAGGTCTTTCCCGTGTTGATATG
TTTTTACAAGATAACGGCCGCATTGTACTTAACGAAGTCAATACCCTGCCTGGTTTCACGTCGTACAGCCGTTATCCCCG
TATGATGGCCGCTGCAGGTATAACGCTCCCCGAACTGATTGACCGCCTGATCGTATTCGCGTTACAGGGGTGATAAGAAT
GAAAAAAGGATTTACTTTTTTAGATGAAATATTACACGGTGTTCGTTGGGACGCTAAATATGCTACATGGGACAATTTCA
CCGGAAAGCCGGTTGACGGATATGAAGTAAATCGCATTGCAGGAACATACGAGTTGGCCGACGCGCTTTTGAAGGTAAAA
GAACTGGCTGCTGCTCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCCCAACGCGCTGTAAATTGTTTTGTGCA
ATGGGCTGCACAGCCGGAAGATGGCCTGACAAAGGAAAGATATTATCCCAATATTGACCGAACCGAGATGGTTTCAAAAG
GATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGTGCGATTGATCTTACGCTTTATCGATTAGACACGGGTGAGCTT
GTACCAATGGGGAGCGGGTTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAAAGGAATTTCAGGCAATGAAGCGCA
AAATCGCAGATGTTTGCGTTCCATCATGGAAAACAGCGGGTTTGAAGCATATAGCTTCGAATGGTGGCACTATGTATTAA
GAAACGAACCATACCCCAATAGCTATTTTGATTTCCCCGTCAAATAA