MEGAResFrom MEG, the Microbial Ecology Group

VANHA

The vanH gene encodes a D-Lac dehydrogenase. This gene is part of the VanA operon and is a core resistance gene.

References

Other Groups in VanA-type resistance protein

Sequences

Download Sequences

>Gly|VanH-A|FJ86609|3762-4730|969|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAATAACATCGGCATTACTGTTTATGGATGTGAGCAGGATGAGGCAGATGCATTCCATGCTCTTTCGCCTCGCTTTGG
CGTTATGGCAACGATAATTAACGCCAACGTGTCGGAATCCAACGCCAAATCCGCGCCTTTCAATCAATGTATCAGTGTGG
GACATAAATCAGAGATTTCCGCCTCTATTCTTCTTGCGCTGAAGAGAGCCGGTGTGAAATATATTTCTACCCGAAGCATC
GGCTGCAATCATATAGATACAACTGCTGCTAAGAGAATGGGCATCACTGTCGACAATGTGGCGTACTCGCCGGATAGCGT
TGCCGATTATACTATGATGCTAATTCTTATGGCAGTACGCAACGTAAAATCGATTGTGCGCTCTGTGGAAAAACATGATT
TCAGGTTGGACAGCGACCGTGGCAAGGTACTCAGCGACATGACAGTTGGTGTGGTGGGAACGGGCCAGATAGGCAAAGCG
GTTATTGAGCGGCTGCGAGGATTTGGATGTAAAGTGTTGGCTTATAGTCGCAGCCGAAGTATAGAGGTAAACTATGTACC
GTTTGATGAGTTGCTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATACGGATACGCACTATATTATCAGCC
ACGAACAAATACAGAGAATGAAGCAAGGAGCATTTCTTATCAATACTGGGCGCGGTCCACTTGTAGATACCTATGAGTTG
GTTAAAGCATTAGAAAACGGGAAACTGGGCGGTGCCGCATTGGATGTATTGGAAGGAGAGGAAGAGTTTTTCTACTCTGA
TTGCACCCAAAAACCAATTGATAATCAATTTTTACTTAAACTTCAAAGAATGCCTAACGTGATAATCACACCGCATACGG
CCTATTATACCGAGCAAGCGTTGCGTGATACCGTTGAAAAAACCATTAAAAACTGTTTGGATTTTGAAAGGAGACAGGAG
CATGAATAG

>Gly|VanH-Ao1|AF060799|534-1580|1047|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGACCTACAGCGAACCAGCGCGATCAGCTGCCCCCCGCACCGGATCGCCGGCGTCCGCCTCCTCCTCGGCCGTCTTGGC
GAGGGGAATCACGATTTATGGTTGCGGATCGGACGAGGCCGCCTTGTTCCGGGAGATGGCTCCTCGTTTCGGCGTAATGC
CGAACATTGTGGACGAGCCGGTATCCGAGGCGAATATCGGGCTGGTCTCCGGAAATCGATGCATCAGTATCGGTCACAAG
ACCAAGGTCACGAATTCCATTCTTCTCGCCCTCGCCGAAGCGGGCGTGGAATACATCTCCACCAGGAGCATCGGCTTCAA
CCACATCGATGTGGAATACGCGGCGAGCGTCGGTATCACCGTGGGCAATGTCGCCTACTCGCCCGACAGCGTCGCCGACT
TCACGCTGATGCTGATGCTGATGGCGGTGCGCGACGCCAAGTCCATCATCCGCCGCACCGAGGTGCACGACTACCGGCTG
AACGAGGTGCGCGGGAAAGAGCTGCGCGATCTGACCGTCGGAGTGGTCGGAACAGGGCGGATCGGGGTCGCGGTGCTGGA
CCGGCTGCGTGGTTTCGGCTGCCGGGTGCTGGCCTACGACACGCTGCTGACCGCCTCGGCCGATTACGTTCCGCTCGACG
AATTGCTCCAGCAGAGCGACATCGTGACGCTCCATGTGCCGCTCAACAACGATACCTATCATCTTCTCGACCGGAAGAAC
ATCGAGCGGATGAAGGACGGCGCGTACATCATCAACACCGGACGTGGCCCGCTCATCGAAACCGAAGCCCTCATTTCGGC
ACTGGAAGACGGCAAACTGGGCGGAGCGGCATTGGACGTCGTCGAAGGAGAGGAAGGCATCTTCTACGCCGACTGCCGGA
ACAAGCCGCTCGAGAGCGAAACGTTGCTGCGGCTGGAAAAGCTGCCGAACGTGCTCATCAGTCCGCATACCGCCTATTAC
ACGGACCACGCACTGAGTGACACTGTTGAAAACTCCATCATCAATTGTCTCCAATTCCGAAAGCGGGAAGTAGTATGGGT
AGGCTGA

>Gly|VanH-Pt2|AY926880|2771-3739|969|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAATAACATCGGCATTACTGTTTATGGATGTGAGCAGGATGAGGCAGATGCATTCTGTGCCCTTTCGCCGCGTTTTGG
CGTTATGCCCTCGATAATTAACGCCAACGTGTCGGAATCCAACGCCAAATCCGCGCCTTTCAATCAATGTATCAGCGTGG
GACATAAATCAGAGGTGTCCGCGTCTATTCTTCTTGCGCTGAAGAGAGCCGGTGTGAAATATATCTCCACCCGAAGCATC
GGCTGCAATCATATAGATACAACTGCCGCTAAGAGAATGGGCATCACTGTCGGCAATGTGGCGTATTCGCCGGATAGCGT
TGCCGATTATACCATGATGCTGATGCTTATGGCAGTACGCAACGCTAAATCTATTGTCCGCTCTGTGGAAAAACATGATT
TCAGGTTGGACAGTGTCCGTGGCAAGGTACTGAGCGACATGACAGTCGGCGTGGTGGGAACGGGCCATATAGGCAAAGCA
GTTATTGAGCGGTTGCGGGGATTTGGATGTAAAGTGCTGGCTTATAGTCGCAGCCAAAGTATAGAGGCAAACTATGTTCC
GTTTGATGAGTTGTTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATGCGGATACGCGCCATATCATCAGCC
ACGAACAAATACAGAGAATGAAGCAAGGCGCGTTTATTATCAATACTGGCCGCGGTCCACTTGTATATACCAATGAGCTG
GTCAAAGCATTAGAAAACGGAAAACTGGGCGGTGCCGCATTGGATGTATTGGAAGGAGAGGAAGAGTTTTTCTACTCTGA
TTGCTCACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGAATGCCGAACGTGATAATCACGCCGCATACGG
CTTTTTATACCGAACAGGCGTTGCGTGATACCGTTGAAAAAACCAATATAAACTGTTTGGATTTTGAAAGGAGCCAGGAG
CATGAATAG

>Gly|VanH-Ao2|HQ679900|1-1032|1032|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGACCTACAGCGAACCAGCGCGATCAGCTGCCCCCCGCACCGGATCGCCGGCGTCCGCCTCCTCCTCGGCCGTCTTGGC
GAGGGGAATCACGATTTATGGTTGCGGATCGGACGAGGCCGCCTTGTTCCGGGAGATGGCTCCTCGTTTCGGCGTAATGC
CGACCATTGTGGACGAGCCGGTATCCGAGGCGAATATCGGGCTGGTCTCCGGAAATCGATGCATCAGTATCGGTCACAAG
ACCAAGGTCACGAATTCCATTCTTCTCGCCCTCGCCGAAGCGGGCGTGGAATACATCTCCACCAGGAGCATCGGCTTCAA
CCACATCGATGTGGAATACGCGGCGAGCGTCGGTATCACCGTGGGCAATGTCGCCTACTCGCCCGACAGCGTCGCCGACT
TCACGCTGATGCTGATGCTGATGGCGGTGCGCGACGCCAAGTCCATCATCCGCCGCACCGAGGTGCACGACTACCGGCTG
AACGAGGTGCGCGGGAAAGAGCTGCGCGATCTGACCGTCGGAGTGGTCGGAACAGGGCGGATCGGGGTCGCGGTGCTGGA
CCGGCTGCGTGGTTTCGGCTGCCGGGTGCTGGCCTACGACACGCTGCTGACCGCCTCGGCCGATTACGTTCCGCTCGACG
AATTGCTCCAGCAGAGCGACATCGTGACGCTCCATGTGCCGCTCAACAACGATACCTATCATCTTCTCGACCGGAAGAAC
ATCGAGCGGATGAAGGACGGCGCGTACATCATCAACACCGGACGTGGCCCGCTCATCGAAACCGAAGCCCTCATTTCGGC
ACTGGAAGACGGCAAACTGGGCGGAGCGGCATTGGACGTCGTCGAAGGAGAGGAAGGCATCTTCTACGCCGACTGCCGGA
ACAAGCCGCTCGAGAGCGAAACGTTGCTGCGGCTGGAAAAGCTGCCGAACGTGCTCATCAGTCCGCATACCGCCTATTAC
ACGGACCACGCACTGAGTGACACTGTTGAAAACTCCATCATCAATTGTCTCCAATTCGAAAGCGGGAAGTAG

>Gly|VanH-Sc_1_AL939117|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGACCTTCTCCTCGACCTCCTCGGCCCCTCCACCGTCACCGCTCCTCCCGGCAACGAGAATCACGGTTTACGGCTGCGG
GCGGGACGAGGCCGCCTTGTTCCGCCGGACGGCACCCCGTTTCGGCGTCGAGGCGACTCTCACGGAGGCCGCCGTATCCG
AAGAGAACGCCGAGATGGCGGCCGGAAACCAATGCATCAGCATTGACCACAAGACCCCGGTCACACCTGCCACTCTCCGC
GCTCTCCACCGGGCCGGCGTGACGTACATATCCACCCGGAGTATCGGTTACAACCACATCGATGTGACATACGCGGCCGG
CGTGGGGATATCCGTCGAGAACGTCACCTACTCCCCCGCCGGCGTGGCCGACTACACCCTGATGCTCATGCTGATGGCGG
TGCGCAACGCGAAATCCACCGTCCGCCGCGCGGAGCTGCACGACTACCGGCTGAACGAGATACGCGGTAAGGAGCTGCGC
GACCTGACCGTCGGAGTGATCGGGACGGGGCGTATCGGTGCGGCGGTCGTGGACAGGCTGCGGGGTTTTGGCTCCCGGGT
ACTGGCCTACGGAAAACGGCCCACCATCGCGGCAGATTACGTCTCTCTCGACGAGTTGCTGCGGTCGAGCGACATCGTGT
CGCTGCACGTACCGCTGACCCCGGACACGCATCACCTTCTCGATCAAAGCCGTATCCGGCGGATGAAAAGTGGCGCTTTC
GTCATCAACACCGGACGCGGCCCGCTCATCGACACCGAAGCGCTGGTACCGGCGTTGGAGAGCGGCAGGTTGAGCGGTGC
GGCGCTGGATGTCATCGAGGGCGAGGAAGGGATCTTCTACGCCGACTGCAGAAACAGAACCATCGAAAGCACGTGGCTCC
CGCGGCTGCAGAAAATGCCGAACGTACTCATCAGCCCGCACACCGCCTATTACACCGACCACGCCCTGATGGACACGGTC
GAGAACTCCATCATCAACTGCCTTAATTTCGGAAGCAGGAAACAGCATGGCTGA

>749|AY618461.1|AY618461|Glycopeptides|VanA-type_resistance_protein|VANHA
CACATCGACGTGGAATACGCCGAGAGCATCGGCATCACCGTCGGTAACGTCGCCTACTCGCCGGACAGCGTCGCGGACTT
CACGCTGATGCTGATGCTGATGGTGATACGCGACGCCAAATCCATCATCCGCCGCACGGAAGTCCATGACTACCGGCTGA
ACGCCGTACGCGGGAAAGAACTGCGCGACCTGACCGTCGGGGTGGTCGGAACAGGGCGCATCGGTGTCGCGGTCATGGAC
AGGTTGAAGGGCTTCGGCTGCCGGGTGCTGGCCTATGACACGATCCCCAACGCCTCCGCCGATTACGTCCCCCTCGACGA
TTTGCTGCAGCAGAGCGATATCGTGACACTTCACGTGCCACTCAACACGGACACGTATCACCTCCTCGATCGTCGGAACA
TCGAGGAGATGAAGGGTGGCGCGTACATCATCAACACCGGGCGCGGTCCACTCATCGAAACCGAGGCCCTCATCTCGGCC
CTGGAAAGCGGAAACCTCGGCGGAGCGGCGCTGGACGTCCTCGAAGGAGAGGAAGGCATCTTCTACGCCGACTGCCGGGA
CAAGGCAATCGACGGCAACAAGCCGTTGCTGCGGCTGCAGGAGCTGTCGAACGTGATCATCAGTCCGCATACCGCCTATT
ACACGGACCACGCTCTGAGCGACACTGTTGAAAACTCCATCATCAATTGCCTCGAATTCGAAAGCGGGAAGTAG

>Gly|VanH-Pt_5_DQ018711|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAAAAACATCGGCATTACCATCTATGGATGTGAGCAGGATGAGGCTGATGTGTTCAAGGAACTTTCGCCGCGCTTTGG
CGTTATACCTGCCATTACAAGCTCTGCCGTATCAGAAACCAACGTAATGTTAGCCCCTGGAAATCAATGTATCAGCGTGG
GGCACAAATCTGAGATTTCCGAATCCATTCTTCTTGCGTTGAAGGAATCCGGCGTCAAATATATCTCTACTCGAAGTATT
GGTTACAATCACATAGACATGAAGGCCGCGGAAAGTATGGGTATTGCTGTCGGGAACGTGGCATATTCACCGGATAGCGT
TGCCGATTATACATTGATGCTGATGCTCATGGCAGTACGCAACGCGAAATCTATTGTGCGCTCTGTGGAAAAACATGATT
TCAAGCTGGACAGCGTCCGTGGCAAGGTACTGCGCGACATGACAGTCGGCGTGCTGGGAACCGGTCATATAGGCAAGAGG
GTTATTGAGCGACTGCGGGGATTTGGATGTCATGTGCTGGCGTATGGTCACAACAAAGAGGCGGCGGCAAATTATGTGTC
CCTCAATGAATTGCTGCAAAAAAGCGACATTCTTACCATTCACGTACCGCTTAGCGCGGACACATACCATATGATCGGTC
GCGAACAGATTAAAGCAATGAAACAGGGCGCGTTTCTTATCAATACAGCGCGAGGCGGGCTTATAGATACCGATGTGCTG
GTTAAAGCATTGGAAAACGGAAAACTGGGCGGCGCCGCATTGGATGTATTGGAGGGAGAGGAAGGACTTTTCTACTTTGA
TTGCACACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGGATGCCGAACGTGATAATCACGCCGCATACGG
CTTACTATACCGAACAGGCGTTGCGTGATACCGTTGAAAATACAATCAAGAACTGTCTGGAATTTGAGAGGAGAGAGACA
CTTGTATAG

>Gly|VanH|DQ246438|124-1179|1056|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGCTGCCTACAATGTCCGCCATGACCTACAGCGAACCAGCGCGATCAGAGGCAAGTCGCTCCCGATCGCTGGCGTCCGC
GCCCTCCTCGGCCGACGAGGCAAGGGGAATCACGATTTATGGCTGCGGTCAGGACGAGGCCGTCCTCTTCAAGGAGATGG
CGCCTCGCTTCGGCATAATGCCGACCATCGCGGAAGCGCCGGTATCCGAAGCCACTATCGAATTGGCGTCAGGTAACCGA
TGCATCAGTGTCGGTCATAAGACTCCGATCTCGAACTCCATTCTCCTCGCGCTCCGTGAGGCGGGTGTGGAGTACATCTC
CACGAGGAGCATCGGGTTCAATCACATCGACGTGAAATACGCCGAGAGCATCGGCATCACCGTCGGTAACGTCGCCTACT
CGCCGGACAGCGTCGCGGACTTCACGCTGATGCTGATGCTGATGGTGATACGCGACGCCAAATCCATCATCCGCCGCACG
GAAGTCCATGACTACCGGCTGAACGCCGTACGCGGGAAAGAACTGCGCGACCTGACCGTCGGGGTGGTCGGAACAGGGCG
CATCGGTGTCGCGGTCATGGACAGGTTGAAGGGCTTCGGCTGCCGGGTGCTGGCCTATGACACGATCCCCAACGCCTCCG
CCGATTACGTCCCCCTCGACGATTTGCTGCAGCAGAGCGATATCGTGACACTTCACGTGCCACTCAACACGGACACGTAT
CACCTCCTCGATCGTCGGAACATCGAGGAGATGAAGGGTGGCGCGTACATCATCAACACCGGGCGCGGTCCACTCATCGA
AACCGAGGCCCTCATCTCGGCCCTGGAAAGCGGAAACCTCGGCGGAGCGGCGCTGGACGTCCTCGAAGGAGAGGAAGGGA
TCTTCTACGCCGACTGCCGGGACAAGGCAATCGACGGCAACAAGCCGTTGCTGCGGCTGCAGGAGCTGTCGAACGTGATC
ATCAGTCCGCATACCGCCTATTACACGGACCACGCTCTGAGCGACACTGTTGAAAACTCCATCATCAATTGCCTCGAATT
CGAAAGCGGGAAGTAG

>348|KF478993.1|KF478993|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGTCCTACAGAGACCTGGGTTTGATCGACAGCGAAGTGATCGCGGAGCGACGCGTCCGAGCGCTCGACGATTCGTCACC
CTCGGCCGTCCCGACCACTGGGGTCAGAGTTTTCGGATGCGGTCACGACGAAGCCGTTTTGTTCCGCGAGATGGGAACCC
GCCTCGGGATAACGCCAAGCATCACCGAGGAAGCGATCAGTGAAACCAACGCTGAACTGGCGCGTGGCAACCGATGCATC
AGCGTGAGCCACAAGACGCAGATCGACAATTCCACGCTGCTGGCGCTGAGCCGAGTCGGAGTGGAGTACATCTCCACCAG
AAGCGTCGGGTACAACCACATCGACGTGGAATTCGCGGCGAGCATCGGCATCTCGGTCGGCAACGTCGACTACTCGCCCG
ACAGCGTGGGCGACTACACACTGATGTTGATGCTGATGACCGTACGCCACGCGAAATCAATTGTCCGCCGCGCCGATACG
CATGATTACCGGCTGAATGACACGCGCGGCAGGGAGCTGCGCGACTTGACCGTCGGGGTGATCGGAACAGGGCGCATCGG
CACAGCAGTCATCGACCGGCTGCAGGGATTTGGCTGCCGCGTGCTGGCACATGACAGCGGGCCTCACGCCTCCGCCGACT
ACGTTCCGCTCGATGAACTGCTGCGGCAGAGCGACATTGTCACGCTCCACACTCCACTCACCGCGGACACACACCATCTC
CTCGATCGCCAACGCATCGACCAGATGAAGCACGGCGCGTACATCGTCAACACGGGTCGCGGACCGCTGCTCGATACCGA
GGCCCTCCTCTCCGCATTGGAGAGCGGCCGGTTGGGCGGCGCGGCGCTCGATGTCGTCGAAGGAGAGGAAGGGATCTTCT
ACGCCGACTGCAGGAACAGGCTCATCGAGAACAAGGCCCTGGTGCGGCTACAGCGCCTGCCGAATGTGCTGATCAGTCCG
CACTCCGCCTACTACACAGACCACGCCCTGAACGACACCGTCGAAAACAGCCTCGTCAACTGCCTGAACTTTGAAAGTGG
GAGAACAGCATGA

>Gly|VanH-Pt|DQ018710|5109-6077|969|Glycopeptides|VanA-type_resistance_protein|VANHA
ATGAAAAACATCGGCATTACCGTTTATGGATGCGAGCAGGATGAGGCAGATGCATTCCGTGCCCTTTCGCCGCGCTTTGG
CATTATGCCCACGATAATTAACGCCGCCGTGTCAGAAGCCAACGCCATATCAGCCCCCTGCAATCAATGTATCAGCGTGG
GACACAAATCCGAGGTTTCCGCGTCTATTCTTCTTGCGCTGAAGAGAGCCGGCGTGAAATATATCTCTACCCGAAGCATC
GGCTGCAATCATATAGATACAACTGCCGCTAAGAGAATGGGCATCGCTGTCGGCAATGTGGCGTATTCGCCGGATAGCGT
TGCCGATTATACCATGATGCTGATGCTTATGGCAGTACGCAACGCCAAATCTATTGTGCGCTCTGTGGAAAAACATGATT
TCAGGCTGGACAGTGTCCGTGGCAAGGTACTGCGCGACATGACAGTCGGCGTGGTGGGAACCGGCCATATAGGCAAAGCG
GTTATTGAGCGGCTGCGGGGATTTGGATGTCATGTGCTGGCTTATGATCGCAGCCAAAAAATAGAGGCAAACTATGTTCC
GTTTGATGCGTTGTTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATGCGGATACGCGCCATATCATCGGCC
ACGAACAAATAAAGAGAATGAAGCAAGGCGCGTTTATTATCAATACTGGGCGCGGTCCACTTGTAGATACCGATGCGCTG
GTTAAAGCATTAGAAAACGGAAAACTGGGCGGTGCCGCATTGGATGTATTGGAGGGAGAGGAAGAGTTTTTCTACTCTGA
TTGCTCACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGAATGCCGAACGTGATAATCACGCCGCATACGG
CTTACTATACCGAACAGGCGTTGCGTGATACCGTTGAAAAAACAATTAAAAACTGTTTGGATTTTGAAAGGAGCCAGGAG
CATGAATAG