MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANYA

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanA operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanA-type accessory protein

Sequences

Download Sequences

>>MEG_7592|Drugs|Glycopeptides|VanA-type_accessory_protein|VANYA
atgaagaaatggttttttttattgttattgttattgttaatatacttaggttatgactacattaataaagcactgttttc
tcaggaaaaagtagaatttcaaaattatgatcaaaatcccaaagaacatttagaaaatagtgggacttctgaaagtaccc
aaatgaaaacaattacagatgaacaggtttatcaaggaaatctgctattaatcaatagtaaatatcctcttcgtcaagaa
agtgtgaaatcagatatcgtgaacttatctaaacatggcgaattaataactggatacgggttgcttgatacgaatattta
tatgtcaaaagaaatagcacaaaaattttcagagatgatcaatgatgctgtaaatgggggcgttagtcattttattatta
atagtggctatcgagactttgatgagcaaagtgtgctttaccaagaaatgggggatagttatgccttaccagcaggttat
agtgaacataattcaggcttatcacttgatgtaggatcaagcttgacgaaaatggaacgagcacctgaaggaaagtggat
aaaagaaaacgcttggaaatacgggttcattttacgttatccagaggacaaaacagatgtaacaggaattcaatatgaac
catggcatatccgctatgttggtttagcccatagtgcaattatgaaggaaaagaatttcgctctcgaggaatatatggat
tatctaaaagaagaaaaaattatttctgttagtgtaaatgaggaaaaatatgagatcttttattatcctgttacaaaaaa
taccaccattcatgtgccttccaatcttcgttgggagatatcaggcaacaatatagatggtgtaattgtgactgtgtttc
ccgaatcaacataa

>>MEG_7593|Drugs|Glycopeptides|VanA-type_accessory_protein|VANYA
atgaggagaagcgagggtgacgacgaaccacgcactctcccgcctcgggcccgggaccgggtgtacaccgcggtcacgcg
ggtgctcgccgtgctcctgctgcccgtggcgttcgtccgtcagcccggccgcgcccgcgagctggcctgcggctgggcgt
tgaggatgcgattcccggcagaggacctcaccgggctcaccgacggcgccagggcggcgttcaccgcggcgcgggccgag
gcgctgtggcgtcacggccagctcgtcggtctcacttccggataccgcgatccccgggtccagcagcggatgttcgagga
ggaggtgcgccgctcagggtccgtggccgccgcacggatgttcgtggcgccgccggccgagtccaaccacgtcaagggca
tggcgctggacgtacgcccgcacgagggcgcgcgctggctggaggcgcacggcgcccgctacgacctctaccgcatctac
gacaacgagtggtggcacttcgaacaccgcccggagtgcggtggcacgccaccacggcggctaccccacccaggcgcggc
ctgggcgagccggaacgggggccgggtctag

>>MEG_7594|Drugs|Glycopeptides|VanA-type_accessory_protein|VANYA
ATGAAGAAGTGGGGGTTTTTATTTTTATTGTGCTTAGGTTTTGTCTTCATTAATAAAGCACTGTTTTTTCAGGAAAAAGT
AGCAGTAGAAATTGAAAATTATGATCAAAATCCCAAAGATCATTTAGATAATAGAGGAACTTCGGAAAGTACCCAAACGA
AAACGATTACAAATGAACAGATTTATCAAGGAAATCTGCTATTATTCAACAGTAAATATCCTGTTCGCCAAGAAAGTGTG
AAGTCAGATATCGTCAATTTATCTAAACATAACGAATTGATAAATGGGTACGGGTTGCTTGATACGAATATTTATATGTC
AAAAGGAATAGCACAAAAATTTTCAGAGATGGTCAATGATGCTTTAAAGGAAGGGGTTAGTCATTTTATTATTAATAGTG
GCTATCGTGACTTTGATGAGCAAAGTGTGCTTTACCAAGAAATGGGGGCTGATTATGCCTTGCCAGCAGGTTATAGTGAA
CATAATTCAGGCTTATCACTTGATGTAGGATCAAGCTTAACGAAAATGGAGCGAGCACCTGAAGGAAAGTGGCTGAAAGA
AAATGCTTGGAAATACGGCTTTATATTACGCTATCCAAAGGATAAGACTGATGTTACTGGAATTCAATATGAACCATGGC
ATATCCGTTATGTTGGTTTCCCTCACAGCGCGATTATGAAAGAAAAGAATTTCGCTCTAGAAGAATATATGGATTTTTTG
AAGGAACAGAAGTCCATTACCACTACAATAGACCACCAAGTCTATAAAATTTTTTACTATCCTATCTCCCAAAATACAAC
GATCCATGTGCCTGCGAATGGCCAGTATGAAATTTCAGGCAACAATATGGATGGCGTGATTGTGACAGTGTATTCTGGTA
AGCGAGACTAA

>>MEG_7595|Drugs|Glycopeptides|VanA-type_accessory_protein|VANYA
ATGAAGAAGTGGGGTTTTTTATTGTTATTTTTATTGTGCTTAGGTTTTGCCTTCATTAATAAAGCACTGTTTTTTCAGGA
TAAAGTAGAGATTCAAAAATATGATCAAAATCACAAAGATAATATAGATAACATAGAGAATATAGGGACCCCCTTAAGTA
TCCAAAAGAATGAGATTGTAAAAGAACAGATCTATCAAGGAAATCTGCTCTTAATCAACAGTAAATATCCTATTCGCCAA
GAGAGTGTGAAATCGGATATCGTAAATTTATCTAAACATAATGAATTGATAAATGGATACGGGTTGCTTAATACGAATAT
TTATCTGTCAAAAGGAATTGCACAAAAGTTTTCAGAGATGATCAATGATGCTGTAAAGGAAGGGGTTAGTCAATTTTTTA
TTAATAGTGGCTATCGTGACTTTGATGAGCAAAGTGTTCTTTACCAAGAAATGGGGGCTGATTATGCCTTGCCAGCAGGT
TATAGTGAACATAATTCAGGCTTATCACTTGATGTAGGATCAAGCTTAACGAAAATGGAGCGAGCACCTGAAGGAAAGTG
GCTGAAAGAAAATGCCTGGAAATACGGCTTTATATTACGCTATCCAAAGGATAAAACTGATGTTACTGGAATTCAATATG
AACCATGGCATATCCGTTATGTTGGTTTCCCTCACAGCGCGATTATGAAAGAAAAGAATTTCGCTCTAGAAGAATATATG
GATTTTTTGAAGGAACAGAAGTCCATTACGACTACAATAGACCACCAAGTCTATAAAATCTTTTACTATCCTATCTCCCA
AAATACAACGATCCCTGTGCCTGCGAATGGCCAGTATGAAATTTCAGGCAACAATATGGATGGCGTGATTGTGACAGTGT
ATTCTGGTAAGCGAGACTAA

>>MEG_7596|Drugs|Glycopeptides|VanA-type_accessory_protein|VANYA
ATGAAGAAGTGGGGTTTTTTATTGTTATTGTGCTTAGGTTTTGTCTTCATTAATAAAGCACTGTTTTTTCAGGAAAAAGT
AGAAATTCAAAATTATGATCAAAATCCCAAAGATCATTTAGATAATAGAGGGACTTCTGAAAGTACGCAAACGAAGACGA
TTACAAATGAACAGATTTATCAAGGAAATCTGCTATTATTCAACAGTAAATATCCTGTTCGCCAAGAAAGTGTGAAGTCA
GATATCGTAAATTTATCTAAACATAACGAATTGATAAATGGGTACGGGTTGCTTGATACGAATATTTATATGTCAAAAGG
AATAGCACAAAAATTTTCAGAGATGGTCAATGATGCTGTAAAGGAAGGGGTTAGTCATTTTATTATTAATAGTGGCTATC
GTGACTTTGATGAGCAAAGTGTGCTTTACCAAGAAATGGGGGCTGATTATGCCTTGCCAGCAGGTTATAGTGAACATAAT
TCAGGCTTATCACTTGATGTAGGATCAAGCTTAACGAAAATGGAGCGAGCACCTGAAGGAAAGTGGCTGAAAGAAAATGC
TTGGAAATACGGCTTTATATTACGCTATCCAAAGGATAAAACTGATGTTACTGGAATTCAATATGAACCATGGCATATCC
GTTATGTTGGTTTCCCTCACAGCGCGATTATGAAAGAAAAGAATTTCGCTCTAGAAGAATATATGGATTTTTTGAAGGAA
CAGAAGTCCATTACGACTACAATAGACCACCAAGTCTATAAAATCTTTTACTATCCTATCTCCCAAAATACAACGATCCA
TGTGCCTGCGAATGGCCAGTATGAAATTTCAGGCAACAATATGGATGGCGTGATTGTGACAGTGTATTCTGGTAAGCGAG
ACTAA

>>MEG_7597|Drugs|Glycopeptides|VanA-type_accessory_protein|VANYA
TTGTTATTGTTATTCTTAATATACTTAGGTTATGACTACGTTAATGAAGCACTGTTTTCTCAGGAAAAAGTCGAATTTCA
AAATTATGATCAAAATCCCAAAGAACATTTAGAAAATAGTGGGACTTCTGAAAATACCCAAGAGAAAACAATTACAGAAG
AACAGGTTTATCAAGGAAATCTGCTATTAATCAATAGTAAATATCCTGTTCGCCAAGAAAGTGTGAAGTCAGATATCGTG
AATTTATCTAAACATGACGAATTAATAAATGGATACGGGTTGCTTGATAGTAATATTTATATGTCAAAAGAAATAGCACA
AAAATTTTCAGAGATGGTCAATGATGCTGTAAAGGGTGGCGTTAGTCATTTTATTATTAATAGTGGCTATCGAGACTTTG
ATGAGCAAAGTGTGCTTTACCAAGAAATGGGGGCTGAGTATGCCTTACCAGCAGGTTATAGTGAGCATAATTCAGGTTTA
TCACTAGATGTAGGATCAAGCTTGACGAAAATGGAACGAGCCCCTGAAGGAAAGTGGATAGAAGAAAATGCTTGGAAATA
CGGGTTCATTTTACGTTATCCAGAGGACAAAACAGAGTTAACAGGAATTCAATATGAACCATGGCATATTCGCTATGTTG
GTTTACCACATAGTGCGATTATGAAAGAAAAGAATTTCGTTCTCGAGGAATATATGGATTACCTAAAAGAAGAAAAAACC
ATTTCTGTTAGTGTAAATGGGGAAAAATATGAGATCTTTTATTATCCTGTTACTAAAAATACCACCATTCATGTGCCGAC
TAATCTTCGTTATGAGATATCAGGAAACAATATAGACGGTGTAATTGTGACAGTGTTTCCCGGATCAACACATACTAATT
CAAGGAGGTAA