MEGAResFrom MEG, the Microbial Ecology Group

VANYA

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanA operon and is an accessory gene.

References

Other Groups in VanA-type accessory protein

Sequences

Download Sequences

>Gly|VanY-A|M97297|9052-9963|912|Glycopeptides|VanA-type_accessory_protein|VANYA
ATGAAGAAGTTGTTTTTTTTATTGTTATTGTTATTCTTAATATACTTAGGTTATGACTACGTTAATGAAGCACTGTTTTC
TCAGGAAAAAGTCGAATTTCAAAATTATGATCAAAATCCCAAAGAACATTTAGAAAATAGTGGGACTTCTGAAAATACCC
AAGAGAAAACAATTACAGAAGAACAGGTTTATCAAGGAAATCTGCTATTAATCAATAGTAAATATCCTGTTCGCCAAGAA
AGTGTGAAGTCAGATATCGTGAATTTATCTAAACATGACGAATTAATAAATGGATACGGGTTGCTTGATAGTAATATTTA
TATGTCAAAAGAAATAGCACAAAAATTTTCAGAGATGGTCAATGATGCTGTAAAGGGTGGCGTTAGTCATTTTATTATTA
ATAGTGGCTATCGAGACTTTGATGAGCAAAGTGTGCTTTACCAAGAAATGGGGGCTGAGTATGCCTTACCAGCAGGTTAT
AGTGAGCATAATTCAGGTTTATCACTAGATGTAGGATCAAGCTTGACGAAAATGGAACGAGCCCCTGAAGGAAAGTGGAT
AGAAGAAAATGCTTGGAAATACGGGTTCATTTTACGTTATCCAGAGGACAAAACAGAGTTAACAGGAATTCAATATGAAC
CATGGCATATTCGCTATGTTGGTTTACCACATAGTGCGATTATGAAAGAAAAGAATTTCGTTCTCGAGGAATATATGGAT
TACCTAAAAGAAGAAAAAACCATTTCTGTTAGTGTAAATGGGGAAAAATATGAGATCTTTTATTATCCTGTTACTAAAAA
TACCACCATTCATGTGCCGACTAATCTTCGTTATGAGATATCAGGAAACAATATAGACGGTGTAATTGTGACAGTGTTTC
CCGGATCAACACATACTAATTCAAGGAGGTAA

>Gly|VanY-A_1_FJ866609|Glycopeptides|VanA-type_accessory_protein|VANYA
TTGTTATTGTTATTCTTAATATACTTAGGTTATGACTACGTTAATGAAGCACTGTTTTCTCAGGAAAAAGTCGAATTTCA
AAATTATGATCAAAATCCCAAAGAACATTTAGAAAATAGTGGGACTTCTGAAAATACCCAAGAGAAAACAATTACAGAAG
AACAGGTTTATCAAGGAAATCTGCTATTAATCAATAGTAAATATCCTGTTCGCCAAGAAAGTGTGAAGTCAGATATCGTG
AATTTATCTAAACATGACGAATTAATAAATGGATACGGGTTGCTTGATAGTAATATTTATATGTCAAAAGAAATAGCACA
AAAATTTTCAGAGATGGTCAATGATGCTGTAAAGGGTGGCGTTAGTCATTTTATTATTAATAGTGGCTATCGAGACTTTG
ATGAGCAAAGTGTGCTTTACCAAGAAATGGGGGCTGAGTATGCCTTACCAGCAGGTTATAGTGAGCATAATTCAGGTTTA
TCACTAGATGTAGGATCAAGCTTGACGAAAATGGAACGAGCCCCTGAAGGAAAGTGGATAGAAGAAAATGCTTGGAAATA
CGGGTTCATTTTACGTTATCCAGAGGACAAAACAGAGTTAACAGGAATTCAATATGAACCATGGCATATTCGCTATGTTG
GTTTACCACATAGTGCGATTATGAAAGAAAAGAATTTCGTTCTCGAGGAATATATGGATTACCTAAAAGAAGAAAAAACC
ATTTCTGTTAGTGTAAATGGGGAAAAATATGAGATCTTTTATTATCCTGTTACTAAAAATACCACCATTCATGTGCCGAC
TAATCTTCGTTATGAGATATCAGGAAACAATATAGACGGTGTAATTGTGACAGTGTTTCCCGGATCAACACATACTAATT
CAAGGAGGTAA

>Gly|VanY-Pt|AY926880.2|5831-6721|891|Glycopeptides|VanA-type_accessory_protein|VANYA
ATGAAGAAGTGGGGGTTTTTATTTTTATTGTGCTTAGGTTTTGTCTTCATTAATAAAGCACTGTTTTTTCAGGAAAAAGT
AGCAGTAGAAATTGAAAATTATGATCAAAATCCCAAAGATCATTTAGATAATAGAGGAACTTCGGAAAGTACCCAAACGA
AAACGATTACAAATGAACAGATTTATCAAGGAAATCTGCTATTATTCAACAGTAAATATCCTGTTCGCCAAGAAAGTGTG
AAGTCAGATATCGTCAATTTATCTAAACATAACGAATTGATAAATGGGTACGGGTTGCTTGATACGAATATTTATATGTC
AAAAGGAATAGCACAAAAATTTTCAGAGATGGTCAATGATGCTTTAAAGGAAGGGGTTAGTCATTTTATTATTAATAGTG
GCTATCGTGACTTTGATGAGCAAAGTGTGCTTTACCAAGAAATGGGGGCTGATTATGCCTTGCCAGCAGGTTATAGTGAA
CATAATTCAGGCTTATCACTTGATGTAGGATCAAGCTTAACGAAAATGGAGCGAGCACCTGAAGGAAAGTGGCTGAAAGA
AAATGCTTGGAAATACGGCTTTATATTACGCTATCCAAAGGATAAGACTGATGTTACTGGAATTCAATATGAACCATGGC
ATATCCGTTATGTTGGTTTCCCTCACAGCGCGATTATGAAAGAAAAGAATTTCGCTCTAGAAGAATATATGGATTTTTTG
AAGGAACAGAAGTCCATTACCACTACAATAGACCACCAAGTCTATAAAATTTTTTACTATCCTATCTCCCAAAATACAAC
GATCCATGTGCCTGCGAATGGCCAGTATGAAATTTCAGGCAACAATATGGATGGCGTGATTGTGACAGTGTATTCTGGTA
AGCGAGACTAA

>Gly|VanY-Pt_3_DQ018710|Glycopeptides|VanA-type_accessory_protein|VANYA
ATGAAGAAGTGGGGTTTTTTATTGTTATTGTGCTTAGGTTTTGTCTTCATTAATAAAGCACTGTTTTTTCAGGAAAAAGT
AGAAATTCAAAATTATGATCAAAATCCCAAAGATCATTTAGATAATAGAGGGACTTCTGAAAGTACGCAAACGAAGACGA
TTACAAATGAACAGATTTATCAAGGAAATCTGCTATTATTCAACAGTAAATATCCTGTTCGCCAAGAAAGTGTGAAGTCA
GATATCGTAAATTTATCTAAACATAACGAATTGATAAATGGGTACGGGTTGCTTGATACGAATATTTATATGTCAAAAGG
AATAGCACAAAAATTTTCAGAGATGGTCAATGATGCTGTAAAGGAAGGGGTTAGTCATTTTATTATTAATAGTGGCTATC
GTGACTTTGATGAGCAAAGTGTGCTTTACCAAGAAATGGGGGCTGATTATGCCTTGCCAGCAGGTTATAGTGAACATAAT
TCAGGCTTATCACTTGATGTAGGATCAAGCTTAACGAAAATGGAGCGAGCACCTGAAGGAAAGTGGCTGAAAGAAAATGC
TTGGAAATACGGCTTTATATTACGCTATCCAAAGGATAAAACTGATGTTACTGGAATTCAATATGAACCATGGCATATCC
GTTATGTTGGTTTCCCTCACAGCGCGATTATGAAAGAAAAGAATTTCGCTCTAGAAGAATATATGGATTTTTTGAAGGAA
CAGAAGTCCATTACGACTACAATAGACCACCAAGTCTATAAAATCTTTTACTATCCTATCTCCCAAAATACAACGATCCA
TGTGCCTGCGAATGGCCAGTATGAAATTTCAGGCAACAATATGGATGGCGTGATTGTGACAGTGTATTCTGGTAAGCGAG
ACTAA

>978|DQ018711.1|DQ018711|Glycopeptides|VanA-type_accessory_protein|VANYA
ATGAAGAAGTGGGGTTTTTTATTGTTATTTTTATTGTGCTTAGGTTTTGCCTTCATTAATAAAGCACTGTTTTTTCAGGA
TAAAGTAGAGATTCAAAAATATGATCAAAATCACAAAGATAATATAGATAACATAGAGAATATAGGGACCCCCTTAAGTA
TCCAAAAGAATGAGATTGTAAAAGAACAGATCTATCAAGGAAATCTGCTCTTAATCAACAGTAAATATCCTATTCGCCAA
GAGAGTGTGAAATCGGATATCGTAAATTTATCTAAACATAATGAATTGATAAATGGATACGGGTTGCTTAATACGAATAT
TTATCTGTCAAAAGGAATTGCACAAAAGTTTTCAGAGATGATCAATGATGCTGTAAAGGAAGGGGTTAGTCAATTTTTTA
TTAATAGTGGCTATCGTGACTTTGATGAGCAAAGTGTTCTTTACCAAGAAATGGGGGCTGATTATGCCTTGCCAGCAGGT
TATAGTGAACATAATTCAGGCTTATCACTTGATGTAGGATCAAGCTTAACGAAAATGGAGCGAGCACCTGAAGGAAAGTG
GCTGAAAGAAAATGCCTGGAAATACGGCTTTATATTACGCTATCCAAAGGATAAAACTGATGTTACTGGAATTCAATATG
AACCATGGCATATCCGTTATGTTGGTTTCCCTCACAGCGCGATTATGAAAGAAAAGAATTTCGCTCTAGAAGAATATATG
GATTTTTTGAAGGAACAGAAGTCCATTACGACTACAATAGACCACCAAGTCTATAAAATCTTTTACTATCCTATCTCCCA
AAATACAACGATCCCTGTGCCTGCGAATGGCCAGTATGAAATTTCAGGCAACAATATGGATGGCGTGATTGTGACAGTGT
ATTCTGGTAAGCGAGACTAA