MEGAResFrom MEG, the Microbial Ecology Group

FOSC

The fosC gene encodes a fosfomycin phosphotransferase that inactivates the antibiotic molecule.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/7492106

Other Groups in Fosfomycin thiol transferases

Sequences

Download Sequences

>>MEG_3016|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSC
GTGTTACGAGGATTGAATCATATTACTATTGCAGTAAGTGACCTTGAACGTTCCGTGGAGTTCTATACGCGTCTATTAGG
AATGAAGGCACATGTCCGCTGGGATAGTGGGGCATATCTGAGCTTGGAGGCTACTTGGATTTGCTTGTCTTGTGACGAAG
TGCATCCGAGCCAAGATTACTGTCACATCGCGTTTGATGTTTCCGAAGAGAATTTCGAACCAGTTACTAAAAAGCTTCGC
GAAGCACATGTCGTTGAATGGAAACAAAATAGAAGCGAAGGACTTTCTTTATACTTGCTCGATCCTGACGGCCATAAATT
GGAAATCCATAGCGGTAGCCTACAAAGTCGTTTGGAATCGTTGAAGTCTAAACCCTATCAAGGGTTAGTATGGCTATAA

>>MEG_3017|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSC
ATGATGACATCGATCATGTTTTCGATGTTGTCGGACATCACGCGGATTTTTGTCGAGCAGGGGCTACGGGTCTATCCCTT
TCAAAGCAGTGCCTTGCTGGGCGTCGATGAAGAGGGGCGTGTCACGCTTCATGCGCGCCAGCTGGCAACGGCCATGGCAT
CGGGTTACATGCCCTTGCTCACTGGGGATCTGCTGCTGCGCGGCGAGCAGGAGGCGCAGGTCTTTTCAAGTGACAATATC
GCCCCGTTGCTCGCTGCGGACTTCGAAGTGCGTCGGGTCTTGTATTACTCCGATGTGGCCGGTGTCTACGACCAGGGCAA
TGCCTTGGTCCCTTGGGTTGGCAATGCCAACGCCGCGTGCATGGAGGCTTGTGTGGGGGCGTCGTCGATGACGGACCTGA
CCGGTGGCATGCGCAACAAGTTCATGCAGCAGCGCCAGTTGGCACGCCTGGGCGTGGTTTCGGAGGTCTTGTCATTCGAG
TGCTTCGACAGGGTGCATCTGTCGTTGTGCGGGTTGCGTCAATTTGGAACCGTGTTCTTGAGCGAGTGA