MEGAResFrom MEG, the Microbial Ecology Group

UHPT

The UHPT group of genes confer resistance to Fosfomycin through the mechanism, Fosfomycin target mutation.

Other Groups in Fosfomycin target mutation

Sequences

Download Sequences

>MEG_7342|Drugs|Fosfomycin|Fosfomycin_target_mutation|UHPT|RequiresSNPConfirmation
ATGCTGGCTTTCTTAAACCAGGTTCGCAAGCCGACCCTGGACCTTCCGCTCGAAGTGCGGCGCAAAATGTGGTTCAAACC
GTTCATGCAATCCTACCTGGTGGTCTTTATCGGCTACCTGACGATGTACCTGATTCGCAAGAACTTTAACATCGCGCAGA
ACGATATGATTTCGACCTACGGGTTGAGCATGACGCAGCTGGGGATGATCGGCCTGGGTTTCTCCATCACTTATGGCGTG
GGTAAAACGCTGGTTTCCTACTACGCCGACGGCAAAAACACCAAACAATTCCTGCCGTTCATGCTGATCCTCTCTGCTAT
TTGTATGCTGGGCTTCAGTGCCAGTATGGGCAGCGGCTCGGTTAGCCTGTTCCTGATGATTGCCTTCTACGCCTTAAGCG
GCTTTTTCCAGAGTACCGGCGGTTCGTGCAGTTACTCCACCATCACCAAATGGACGCCGCGTCGTAAACGCGGGACATTC
CTCGGTTTCTGGAATATTTCTCACAACCTTGGCGGTGCAGGCGCAGCAGGTGTGGCGCTGTTCGGGGCAAATTACCTGTT
CGATGGCCATGTCATCGGCATGTTTATCTTCCCGTCGATTATCGCGCTGATTGTCGGTTTTATCGGCCTGCGTTACGGCA
GCGACTCCCCGGAATCTTATGGCCTCGGCAAAGCTGAAGAACTGTTCGGCGAGGAGATCAGCGAAGAGGACAAAGAGACA
GAATCTACCGATATGACCAAGTGGCAGATCTTTGTTGAGTATGTGCTGAAAAACAAAGTGATCTGGCTGCTGTGCTTCGC
CAACATTTTCCTCTATGTGGTACGTATTGGTATCGACCAGTGGTCAACCGTATACGCGTTCCAGGAACTGAAACTCTCTA
AAGCGGTGGCGATTCAGGGCTTTACGCTGTTTGAAGCTGGTGCGCTGGTCGGTACGCTGCTGTGGGGCTGGCTCTCTGAC
CTGGCGAACGGTCGCCGTGGCCTGGTGGCCTGCATCGCGCTGGCGCTGATTATCGCCACGCTCGGTGTGTATCAACATGC
CAGTAACGAATATATCTATCTGGCTTCTCTCTTTGCGTTGGGTTTCCTGGTCTTTGGCCCGCAATTGTTGATTGGTGTGG
CTGCTGTTGGCTTTGTACCTAAAAAAGCGATTGGCGCTGCCGATGGTATTAAAGGCACCTTTGCTTACCTGATTGGTGAC
AGCTTTGCCAAGTTAGGTCTGGGAATGATTGCCGATGGGACGCCGGTATTCGGCCTTACCGGCTGGGCAGGCACCTTCGC
CGCGCTGGATATCGCCGCGATTGGTTGTATCTGCCTGATGGCGATAGTGGCGGTAATGGAAGAACGCAAAATCCGCCGCG
AGAAAAAAATTCAGCAGTTGACAGTGGCATAA

>MEG_7343|Drugs|Fosfomycin|Fosfomycin_target_mutation|UHPT|RequiresSNPConfirmation
ATGAACTTTTTTGATATCCATAAGATTCCGAACAAAGGCATTCCATTATCGGTACAACGTAAATTATGGCTTAGAAACTT
CATGCAAGCTTTCTTCGTAGTGTTCTTTGTTTATATGGCTATGTATTTAATTCGAAACAACTTTAAGGCGGCACAACCGT
TTTTAAAAGAGGAAATTGGATTATCTACATTAGAACTTGGTTATATCGGATTAGCATTTAGTATCACGTACGGTTTAGGG
AAAACATTACTTGGATATTTTGTCGATGGACGTAACACAAAACGTATTATCTCATTCTTACTTATCTTATCTGCGATTAC
AGTTTTAATTATGGGATTTGTTTTAAGTTACTTTGGTTCAGTAATGGGATTATTAATTGTACTTTGGGGACTTAACGGGG
TGTTCCAATCAGTTGGTGGACCTGCAAGTTATTCAACGATTTCAAGATGGGCGCCAAGAACGAAACGTGGCCGATACTTA
GGGTTTTGGAATACATCACATAATATCGGTGGTGCCATTGCAGGTGGTGTTGCACTTTGGGGTGCTAATGTATTCTTCCA
TGGAAATGTTATAGGGATGTTCATTTTCCCATCGGTGATTGCATTACTTATTGGTATCGCAACATTATTTATCGGAAAAG
ATGATCCAGAAGAATTAGGATGGAATCGTGCTGAAGAAATTTGGGAAGAGCCGGTTGATAAAGAAAATATTGATTCTCAA
GGTATGACAAAATGGGAGATCTTTAAAAAATATATCCTGGGAAATCCTGTTATATGGATTCTATGTGTTTCAAACGTCTT
TGTATACATTGTACGAATCGGTATTGATAACTGGGCACCGTTATATGTGTCAGAGCATTTACACTTTAGTAAAGGCGATG
CAGTTAATACGATATTCTACTTTGAAATTGGTGCTTTAGTTGCAAGTTTATTATGGGGCTACGTATCAGACTTATTAAAA
GGTCGTCGTGCAATTGTAGCTATTGGCTGTATGTTTATGATTACATTTGTTGTCTTATTCTACACAAATGCTACAAGTGT
AATGATGGTTAACATTTCATTGTTTGCATTAGGTGCGTTAATCTTTGGTCCGCAATTATTAATTGGTGTATCATTGACTG
GTTTTGTTCCTAAAAATGCCATCAGTGTAGCAAACGGAATGACAGGTTCATTCGCGTATCTATTCGGTGACTCAATGGCA
AAAGTTGGTTTGGCGGCTATTGCTGATCCAACACGTAACGGTTTAAACATCTTTGGATATACATTAAGTGGATGGACAGA
TGTTTTCATCGTCTTCTATGTTGCATTATTCCTAGGCATGATTCTATTAGGAATCGTTGCTTTCTATGAAGAAAAGAAAA
TTAGAAGTTTAAAAATCTAA