MEGAResFrom MEG, the Microbial Ecology Group

PARC

ParC and ParE are the two components of the bacterial DNA topoisomerase IV. Mutations in these proteins can cause resistance to fluoroquinolones via evasion of the mechanism of action.

References

Other Groups in Fluoroquinolone-resistant DNA topoisomerases

Sequences

Download Sequences

>Flq|NC_012491.1.7720231|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGCTGTCCAATCAAATTATTAATCAGAGCTTCGCGGAGATTATGGGAAAGCGCTTTGGGGACTATGCCAATCTGGTTAT
TCTCTCACGCGCGATCCCAGATGCTCGCGATGGACTAAAACCGGTACAGCGCCGTATTTTGTATGCCATGTACCAAGAAG
GCAACACGAACGATAAACCATACCGGAAATCAGCGAAAACAGTCGGGTACGTGATGGGTACCTATCACCCGCACGGTGAC
TCGGCGATTTACGAAACGATGGTGCGGATGGCGCAATGGTGGAAAATGCGACAGGTGCTCATTCAAGGCCACGGAAACTT
TGGTAGCTTGGATGCAGATCCGCCAGCCGCTATGCGTTATACCGAATCAAGACTGTCAGCATTGGCCAATGAGCTACTGC
GTGATATTGAAAAGGATACGGTTACATTCATCCCGAACTACGACAACTCCGCTCAACAACCGGCAGTATTGCCTTCACGG
TTTCCCAATCTTCTCGTGAATGGCGCTGCTGGGATCGCGGTTGGTTTTGCAACAGACATCCCTACTCACAATTTGGGTGA
AGTCATCGATGCGGCTGTTGCCCAGATGAAGAACCCGAATATCTCGCTGGATGAGCTGATGCAGCACGTCAAAGGTCCAG
ATTTTCCAACTGGCGGTATTGTTCAAGGGCTGTCCGGAATTCGCAAGGCGTTTGAGACAGGCCGTGGCCAATTCATCATT
CGCGGGAAGACCCATGTAGAGGAGCCAAAAGGCGGCAAGATCAAAAAAATCGTCGTTTCCGAAATCCCTTACGAAGTGGT
CAAGTCGAAGCTCGTCGGCCAAATCGATGAGCTTGTGATGGAGCGCAAAATCGAGGGGGCACTGGCGGTTCGCGATGAAA
CGGGTCGCAAAGAGGCCGAGCAGAAAAAAGTACGCATCGTAGTGGATATTCGCAAAGAAGCGGATGAGCAGGCGATTCTC
AACTACCTGTACAAAAATACCGATCTGCAAATCTATTACAATTACAACATGAACGTGATTCATGAGGGGACCATCCGTCA
GATGGGACTCAAGGCTTTGTTGGGGGCGTACATCGACCACCAAAAAGAAGTCGTCACGAATCGCTGCCAATATGATCTGG
ATCGAAAGCAAAGCCGCGAGCATATCGTGGAAGGCTTGATTCGCGCCAAGTCCATTTTGCGTCAGATCGTCGATACGATT
ATGGATTCGGAAGACCGTGCAGATGCCAAGAAAAACATCATGGAGAAATACGGCTTCACCGACAACCAAGCCGATGCGAT
CTTGAGCATTCAGCTCGCTTCTTTGACACGCTTGGATATCGTCAAGCTGGAAAAAGAATTGGCTACATTAGCAAAAGAAA
TCGAGGAACTGAAATCGATTTTGGCAAGCGAGAAAAAGCTGATTCAAGTCATTACAGGCGAGCTGAACGAGATCAAGAAA
AAATACGCAGAAGAGCGTCTAACAGAAATCCAGGGCGAGATCGAGGAAATCAAAATCGATATTGCCATGCAAATCAATGC
AGAGGATTGTATCGTAACCCTGACGAACGAAGGATATATCAAGCGGACGAGCCCGCGCTCCTTCAAATCAGTGGGGGGAA
CGCTGGAGACATGTGGGGTAAAAGAAGGCGACCGTGTCCGTTATTTCATGGAGACGAATACGTCTCACACTGCTCTCTTC
TTTACCCAGGATGGTAAATACTTTGCCACACTGGTTAACGCCTTCCCGGACGATAAGTGGAAGGATATCGGTTCGGCTCT
CGTCAATATCATCCCGTTGGAAAAGAATCAGCGGATCGTTGGCTTTACGATCGTAGAAAACTTCAAACAACCGCTGTATG
TATACCATGTAAGTAAAAATGGTTTGATGAAAAAGACGGCGTTGTCCGAATACGAAACCAATCGTTCGAGTGCGTTGGTA
GCTGCAAAGCTAAAAGGCGGCGATGACGAGTTTATGAATGTATTCGTGGCGGACGAAGCTGGAGCAATACTCGGTGCGAC
GAAAGATGGCATGGGCATCCGATTCCAGCGCAGCGAAGTCAGCGCAACGGGTAGAGCGTCGAGCGGGGTAAAAGCGATCG
CACTTGCTCCTGGCGATGATGTCATCACGATGCTTCCGATTGAGGAAGTCGATTCGCGTGCCTTTAGCTTGTTGACGGCT
GAAGGGGTTGTAAAACGCACAGCCATTGGTGCAATCCCACTTCAGGCTCGCGCAGGCAAAGGGGTACAGTTGATTCGTAA
ACGAAAAAATAACCCGCATGAGCTTGTTGCGATGTTCCTCGAGGAAACGGTTTATGCCTGGACGTCGCAGAACGAATGGA
CCCTTGTTGAGACAGAGCAAGTGATCGTCAACGAGCAAGGTGGTATTGGCCGACAACTGATCGAGGGTGGGGTAAAAGCA
GTTGCTTTTGAAACCATTTTGCCGACAGATGAACCGAAGGACGAAGCGACGGCAAAAGGCTCAGGAGACGGATCTGGCAC
AGCAGGGCAACAGAAAACGTCGAATGTCCAGGCTAATTTGTTCGATGGAGATCATCGTAAATAA

>Flq|NC_011586.7046300|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGACCAGCCTTGCGCATCATGCGACAGAAAACCGCTCTGTAGCCGAATTTACTGAACAGGCTTACTTGAATTATGCCAT
GTACGTCATTATGGACCGTGCATTGCCGCATATCAGTGATGGCTTAAAGCCCGTACAGCGCCGTATTGTCTATGCCATGA
GCGAGCTAGGCTTAAAAAGCAGTGGCAAGCCAAAAAAATCAGCGCGTACAGTGGGTGATGTACTTGGTAAATACCACCCA
CATGGTGACTTGGCATGTTATGAAGCCATGGTACTCATGGCTCAGCCATTTAGTTATCGTTATCCGCTAATTGAAGGACA
GGGGAACTGGGGTTCACCAGATGATCCTAAATCTTTTGCTGCGATGCGTTATACCGAAGCCAAACTCTCGGCTTATAGTG
AATTATTGCTGAGCGAATTAGGCCAGGGCACTAGCGAATGGCAAGATAACTTTGATGGTTCTTTAAAAGAACCGATCACT
TTACCTGCACGTGTACCTAATATTCTTCTTAATGGTACGACAGGTATTGCTGTCGGGATGGCAACTGATATCCCGCCACA
TAATTTGCGTGAAGTTGTAAAAGGCACAATTGCTTTAATCCGTAATCCGCAAACCTCGGACGAAAAATTAGCTGAATATA
TTCCGGCTCCGGATTTACCAACCAAAGCTGAAATTATTACCCCGCCAGAAGAATTACTCAAAATCCAGACCACTGGTCGT
GGTAGTTACCGTATGCGAGCGGTATATACCATTGAGAAAAATGAAATCGTAATTACTGAGCTGCCATATCAAGTCTCTGG
TTCTAAGGTAATTACTCAAATTGCTGACCAGATGCAGGCTAAAAAGCTGCCATTAGTCGTCGACGTGCGTGATGAATCGG
ATCATGAAAACCCGACACGACTCGTGATTGTACTGCGCTCTAACCGTATTGATGCGGAAGCAGTGATGAGTCACTTATTT
GCGACCACTGATTTAGAATCAAGCTATCGTGTCAATTTAAACATGATTGGCGAAGATGGCCGTCCTCAGGTGAAATCAAT
TCGTCGTATTTTGCTTGAATGGATCGAGATCCGTAAAAAAACGGTAACTCGTCGTTTACAGTACCATTTAAACCGTATTG
AAAAGCGCCTGCATATTTTGGCAGGTCTTTTAATTGCTTATCTCGATATTGATACAGTCATTCGTATTATTCGTGAAGAA
GACCAGCCTAAGCCAGTCTTAATGGAACACTTCAATATTGATGAGATACAGGCCGAAGCGATTTTAGAGCTTAAATTACG
TCATTTGGCAAAGCTTGAAGAGATGGAAATCCGTCATGAACAAGATGAACTTTCTGCGAAAGCTGCCATTATTCGTGAAC
AACTCGAAAATCCTGAATCTTTAAAAAATTTGATTATTGGCGAATTAAAAGAAGATGCGAAAAAGTTCGGTGATGAGCGC
CGTTCTCCAATTGTTGCACGTGCTGAAGCGGTTCAAATTAAAGAACAGGATTTAATGCCAGCTGAAACGGTAACGGTGGT
TTTGTCTGAAGCAGGCTGGGTTCGTGCGGCAAAAGGTGCGGATGTGGATGCTGAAAATCTGAACTACCGTGCTGGGGACC
AATATTTAAGTCATGCTGTCGGGAAAACCAATCAGCGAGTTTACTTCCTTGATGAAACAGGGCGCAGCTATGCCTTGCCG
ATTAGTAACTTACCTTCAGCGAGAGGCTTGGGGGATCCATTAAGTTCTAAATTATCACCAGCAAGTGGCGTATCGTTTAT
TCAGGTTTATTTAGATGATGATGAGTCTGAATTGATTGCTGCAAGTTCGGCAGGTTATGGTTTTAAAACGCAAACCAAGC
AATTAGATACCAATGCGAAAGCCGGTAAGACATTCTTAACGGTTCCGGATAAGGCAAAGGCTTTACCACTCATTTCTGCC
CAAAACATGACGCATTTGGCTGTACTGAGCTCAGCAGGGCGTTTGTTAATTTTAGATTTGGCAGAGCTACCAAATTTAAA
TAAAGGTAAAGGTAATAAGTTGATACAACTTGAAGGCAAAGAGCAAATTTTATCCATGACAACCCTGAACTTAGATGAAA
TAATTCAGGTGGTTGCAGGTCAACAACATCTCAAATTAAAAGGTGATGATCTACAAAAATACATGGGTAAACGTGCTTCG
AAAGGTCAGCTCTTACCACGTGGATATCAAAAAGCAAATAAACTGTTGATTCAGAGATAA

>Flq|AE016830.1|gene1598|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
TTGGAAAAACGCCAAGAAGTTCAAGAATTAACCCTTGAAGAAGTAATGGGCGATCGTTTTGGAAGATATTCCAAATACAT
CATTCAAGAACGGGCCCTACCAGATATTCGAGATGGGCTAAAACCAGTACAACGCCGCATTCTCTTTTCAATGAATAAAG
ACGGCAATACCTTTGATAAAGGCTTTCGTAAATCAGCAAAATCTGTCGGAAACATTATGGGGAATTATCATCCCCATGGC
GACAGCAGTATTTATGAAGCGATGGTGCGTCTAAGTCAAGACTGGAAATTACGGGAAGTACTAATTGAAATGCACGGAAA
CAACGGAAGTATGGATGGCGACCCACCAGCGGCGATGCGTTATACAGAAGCTCGTTTATCACAGTTAAGTGGTGAGTTGT
TAAAAGATATCGACAAAAATACCGTCGATTTCGTCTGGAATTTTGACGATACAGAAAAAGAACCCACTGTTTTACCAGCC
AAATATCCTAATTTATTGGTAAACGGCTCAACGGGGATTTCAGCAGGCTATGCAACAGAAATTCCTACGCATAATTTAGC
GGAAATCATTGATGGAACTGTGTATTTAATTGATCATCCTAATGCAAGTTTAGAGAAATTAATGGAATACATTCCAGGAC
CAGATTTCCCAACAGGTGGGATTCTACAAGGAAAAGCAGAAATTAAAAAAGCCTACGAAACCGGCCGTGGTAAAGTAATT
TTACGTGCGAAGACAAAGATTGAGCCTTTAAAAGGCGGCAAACAACAAATTGTCATTTCTGAAATTCCTTATGAAGTCAA
CAAAGCAACGCTAGTGAAGAAGATGGATGAAATCCGTTTAAATAAAAAAGTAGACGGCATTGCCGAAGTTCGTGACGAAA
GTGACAGAACTGGCTTGCAAATTGTTGTTGAACTAAAAAAAGATGTCAATGCAGAAGGTATTTTAAATTATCTATTTAAA
AACACTGAATTGCAAATCAATTACAACTTTAACATGGTAGCCATCGACAACATGACCCCGCAACAAGTGGGCCTAAAACG
GATTTTAGAAAGTTACATTACGCATCGCAAATCAGTTATCATTAACCGTTGTCAATTTGAGTTGGACAAAGCTCGCAAAC
GTGAGCACATTGTTGCTGGTTTAATTAAAGCATTGTCTATCTTAGATAAAGTGATTGCAACAATCCGTGGCAGTAAAGAT
AAAAAAGATGCGAAGAAGAACTTAGTATCCGACTATGCGTTTACTGAAGAACAAGCTGAAGCAATCGTTACTTTACAGCT
ATACCGTTTAACCAATACGGATATTACTGATTTACAAGAAGAAGCGAAAACTTTAGAACAACAAATTGCTGAGTTATTGA
ACATTTTAAACAATGAAAAAGAACTATTCTCAGTCATGAAAAAAGAACTTCGCGAAGTTAAAAAGCAATATGGCAATCCG
CGCTTAACTCAAATTGAAGAGGAAATCCAAGAAATCAAGATTGAAACAGCCGTGTTAGTTGCGCAGGAAGACGTGGTCGT
AACCGTGACGCACGAAGGCTATATCAAGCGGAGTAGTATTCGTTCTTATACAGCATCAAAACCAGAAGAAATCGGCATGA
AAGAAGGCGACTTTTTATTATATGCTGGCGAAGTCAATACATTAGATCATCTTTTACTAGTAACAAATAAAGGGAATATG
ATCTATCGCCCCGTCCATGAGTTGCCAGATTTACGCTGGAAAGAAATTGGCGAACATATTTCTCAAACCATTTTAAATCT
TGCTATCGATGAATCGATTATTGCTGTATATCCTTATAAAGAGTTAAGTCCGACAAAAACCTTTGTTTTCATTACAAAAG
CTGGCATGATTAAACAAACCAAAATGGCTGATTTTGAGCCTTGGCGCACTTATAAGAGCCGCCCGACATCTTGTATGAAA
TTAAAATCAGACCAAGATGAAATTACCAATGTTTATTTAACAAATGATCAAGACTTATTGGATGTTTTCCTCGTTAGCAA
TCGCGGTTTTGGCTTACGTTATCCATTATATGAAGTACCAGTCGTGGGTAGTAAAGCGGCTGGAGTTAAATCAATGAACC
TCAAAGAAGACGATTATGTCGTTAATGGTTTACTGGTTCATTCTGAAGGGGATACACCGATTGTCATCGTTACCCAACGT
GGCGGTGTTAAACGCATGTTAGCCCAAGAATTAACACAATTAGGACGAGCAAAACGTGGACTAATGGTCTTGCGGGAATT
GAAGAAAAATCCACATCGTGTTGTCTTTATGTCTGAAAGTACCGATTTAGATTTATTAGTTACTACGCAAAAGGGCACAC
AAGAAGTTATTCAGTCGAAAAACTATCCAATCAGTGAACGAACATCCAACGGTTCCTTTGTCATCGATGAACAAAAAGAT
GGCCAAGTAATGGAAGTCCACGAGATGCATTCTGCAGTGATTGAAGAAGAACAAACAAACTAA

>Flq|NC_003923.1003354|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
GTGAGTGAAATAATTCAAGATTTATCACTTGAAGATGTTTTAGGTGATCGCTTTGGAAGATATAGTAAATATATTATTCA
AGAGCGTGCATTGCCAGATGTTCGTGATGGTTTAAAACCAGTACAACGTCGTATTTTATATGCAATGTATTCAAGTGGTA
ATACACACGATAAAAATTTCCGTAAAAGTGCGAAAACAGTCGGTGATGTTATTGGTCAATATCATCCACATGGAGACTCC
TCAGTGTACGAAGCAATGGTCCGTTTAAGTCAAGACTGGAAGTTACGACATGTCTTAATAGAAATGCATGGTAATAATGG
TAGTATCGATAATGATCCGCCAGCGGCAATGCGTTACACTGAAGCTAAGTTAAGCTTACTAGCTGAAGAGTTATTACGTG
ATATTAATAAAGAGACAGTTTCTTTCATTCCAAACTATGATGATACGACACTCGAACCAATGGTATTGCCATCAAGATTT
CCTAACTTACTAGTGAATGGTTCTACAGGTATATCTGCAGGTTACGCGACAGATATACCACCACATAATTTAGCTGAAGT
GATTCAAGCAACACTTAAATATATTGATAATCCGGATATTACAGTCAATCAATTAATGAAATATATTAAAGGTCCTGATT
TTCCAACTGGTGGTATTATTCAAGGTATTGATGGTATTAAAAAAGCTTATGAATCAGGTAAAGGTAGAATTATAGTTCGT
TCTAAAGTTGAAGAAGAAACTTTACGCAATGGACGTAAACAGTTAATTATTACTGAAATTCCATATGAAGTGAACAAAAG
TAGCTTAGTAAAACGTATCGATGAATTACGTGCTGACAAAAAAGTCGATGGTATCGTTGAAGTACGTGATGAAACTGATA
GAACTGGTTTACGAATAGCAATTGAATTGAAAAAAGATGTGAACAGTGAATCAATCAAAAATTATCTTTATAAAAACTCT
GATTTACAGATTTCATATAATTTCAACATGGTCGCTATTAGTGATGGTCGTCCAAAATTGATGGGTATTCGTCAAATTAT
AGATAGTTATTTGAATCACCAAATTGAGGTTGTTGCAAATAGAACGAAGTTTGAATTAGATAATGCAGAAAAACGTATGC
ATATCGTTGAAGGTTTGATTAAAGCGTTGTCAATTTTAGATAAAGTAATCGAATTGATTCGTAGCTCTAAAAACAAGTGT
GACGCTAAAGAAAACCTTATCGAAGTATACGAGTTCACAGAAGAACAGGCTGAAGCAATTGTAATGTTACAGTTATATCG
TTTAACAAACACTGATATAGTTGCGCTTGAAGGTGAACATAAAGAACTTGAAGCATTAATCAAACAATTACGTCATATTC
TTGATAACCATGATGCATTATTGAATGTCATAAAAGAAGAATTGAATGAAATTAAAAAGAAATTCAAATCTGAACGACTG
TCTTTAATTGAAGCAGAAATTGAAGAAATTAAAATTGACAAAGAAGTTATGGTGCCTAGTGAAGAAGTTATTTTAAGTAT
GACACGTCATGGATATATTAAACGTACTTCTATTCGTAGCTTTAATGCTAGCGGTGTTGAAGATATTGGTTTAAAAGATG
GTGACAGTTTACTTAAACATCAAGAAGTAAATACGCAAGATACCGTACTAGTATTTACAAATAAAGGTCGTTATCTATTT
ATACCGGTTCATAAATTAGCAGATATTCGTTGGAAAGAATTGGGACAACATGTATCACAAATAGTTCCTATCGAAGAAGA
TGAAGTGGTTATTAATGTCTTTAATGAAAAGGACTTTAATACAGATGCATTTTATGTTTTTGCGACTCAAAATGGCATGA
TTAAGAAAAGTACAGTGCCTCTATTTAAAACAACGCGTTTTAATAAACCTTTAATTGCTACTAAAGTTAAAGAAAATGAT
GATTTGATTAGTGTTATGCGCTTTGAAAAAGATCAATTAATTACCGTCATTACTAATAAAGGTATGTCATTAACGTATAA
TACAAGTGAACTATCAGATACCGGATTAAGGGCAGCTGGTGTTAAATCAATAAATCTTAAAGCTGAAGATTTCGTTGTTA
TGACAGAAGGTGTTTCTGAAAATGATACTATATTGATGGCCACACAACGCGGCTCGTTAAAACGTATTAGTTTTAAAATC
TTACAAGTTGCTAAAAGAGCACAACGTGGAATAACTTTATTAAAAGAATTAAAGAAAAATCCACATCGTATTGTAGCTGC
ACATGTAGTGACAGGTGAACATAGTCAATATACATTATATTCAAAATCAAATGAAGAACATGGTTTAATTAATGATATTC
ATAAATCTGAACAATATACAAATGGCTCATTCATTGTAGATACAGATGATTTTGGTGAAGTAATAGACATGTATATTAGC
TAA

>Flq|CP001138.1|gene3329|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAGCGATATGGCAGAGCGCCTTGCGCTACATGAATTTACGGAAAACGCCTACTTAAACTACTCCATGTACGTGATCAT
GGATCGTGCGTTGCCGTTTATTGGCGACGGCCTGAAGCCGGTACAGCGCCGCATCGTCTATGCGATGTCAGAGCTGGGGC
TGAACGCCAGCGCTAAATTTAAAAAATCCGCCCGTACCGTCGGTGACGTACTGGGTAAGTATCATCCGCACGGCGACAGC
GCCTGCTATGAAGCCATGGTGCTGATGGCGCAGCCGTTCTCTTACCGTTACCCGCTGGTCGATGGCCAGGGAAACTGGGG
CGCGCCGGATGATCCGAAGTCATTCGCGGCAATGCGTTATACCGAATCTCGCCTGTCCAAATATGCCGAGCTGCTGTTAA
GCGAACTCGGCCAGGGGACGGCGGACTGGGTGCCAAACTTCGACGGCACGATGCAGGAACCGAAAATGTTACCGGCGCGT
CTGCCGAACATCCTGCTGAACGGCACCACCGGTATTGCGGTGGGGATGGCAACAGATATCCCGCCGCACAACCTGCGCGA
AGTGGCGAAAGCGGCGATTACGCTGATTGAGCAGCCGAAAACGACGCTGGATCAGTTGCTGGATATCGTCCAGGGGCCGG
ATTACCCGACCGAAGCGGAGATCATTACCCCACGTGCGGAAATTCGTAAAATTTACGAAAACGGGCGGGGCTCCGTGCGT
ATGCGCGCGGTATGGACCAAAGAAGACGGCGCCGTGGTAATTTCCGCGCTGCCGCATCAGGTCTCTGGCGCGAAAGTGCT
GGAACAGATTGCTGCGCAGATGCGTAATAAAAAACTGCCGATGGTGGACGATCTGCGCGATGAATCAGATCACGAAAACC
CGACGCGTTTAGTGATTGTCCCGCGCTCCAACCGTGTGGATATGGAGCAGGTGATGAACCATCTGTTCGCCACCACCGAT
CTGGAAAAAAGCTACCGTATTAACCTGAACATGATCGGTCTGGATGGTCGTCCGGCGGTGAAAAACCTGCTGGAGATCCT
CACCGAGTGGTTGGCGTTCCGTCGCGACACGGTACGCCGTCGTCTGAACTATCGTCTGGAGAAAGTGCTTAAGCGCCTGC
ATATTCTCGAAGGTTTGCTGGTGGCGTTTCTCAACATCGACGAAGTGATTGAGATTATCCGTAACGAGGATGAGCCAAAA
CCCGCGCTGATGTCGCGTTTCGGCATCAGCGAAACCCAGGCGGAAGCGATTCTCGAACTGAAACTGCGCCATCTCGCCAA
ACTGGAAGAGATGAAAATTCGCGGCGAGCAGGACGAGCTGGAAAAAGAGCGTGACCAGTTGCAGGGCATTCTCGCGTCCG
AACGCAAAATGAATACCTTGCTGAAAAAAGAACTACAGGCGGACGCCGATGCCTATGGCGACGATCGCCGTTCTCCGCTG
CGTGAGCGCGAAGAAGCTAAAGCGATGAGCGAACACGACATGCTGCCGTCCGAACCGGTGACTATCGTGCTGTCGCAGAT
GGGCTGGGTGCGCAGCGCCAAAGGTCATGATATTGATGCGCCGGGGCTTAACTATAAAGCGGGCGACAGCTTTAAAGCCG
CGGTGAAAGGTAAGAGCAATCAACCGGTGGTGTTTATTGATACCACCGGGCGCAGCTATGCTATTGATCCCATTACGCTT
CCGTCGGCGCGTGGGCAGGGCGAGCCGCTGACCGGCAAACTCACGCTGCCGCCGGGGGCGACCGTGGAGCATATGCTGAT
GGAAGGCGATGACCAGAAACTGCTGATGGCGTCGGATGCGGGCTACGGCTTCGTTTGTACGTTTAACGATCTGGTTGCCC
GTAACCGTGCCGGTAAAGCGTTGATTACACTGCCGGAAAATGCGCACGTCATGCCGCCGCTGGTGATTGAAGACGAGCAC
GATATGCTGCTGGCGATTACCCAGGCCGGACGGATGTTGATGTTCCCGGTAGACTCTCTGCCGCAGCTGTCGAAAGGCAA
AGGGAATAAGATCATTAATATCCCCTCTGCGGAAGCGGCGAAAGGCGATGATGGACTGGCGCACCTGTACGTGCTGCCGC
CACAAAGCACTCTGACTATCCATGTCGGGAAGCGCAAAATCAAACTGCGCCCTGAAGAGTTACAGAAGGTGGTCGGCGAA
CGCGGACGCCGTGGCACATTAATGCGCGGCCTGCAGCGTATCGATCGCATTGAGATTGATTCACCGCATCGCGTAAGTCA
TGGCGACAGCGAAGAGTAA

>Flq|NC_002758.1121330|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
GTGAGTGAAATAATTCAAGATTTATCACTTGAAGATGTTTTAGGTGATCGCTTTGGAAGATATAGTAAATATATTATTCA
AGAGCGTGCATTGCCAGATGTTCGTGATGGTTTAAAACCAGTACAACGTCGTATTTTATATGCAATGTATTCAAGTGGTA
ATACACACGATAAAAATTTCCGTAAAAGTGCGAAAACAGTCGGTGATGTTATTGGTCAATATCATCCACATGGAGACTTC
TCAGTGTACGAAGCAATGGTCCGTTTAAGTCAAGACTGGAAGTTACGACATGTCTTAATAGAAATGCATGGTAATAATGG
TAGTATCGATAATGATCCGCCAGCGGCAATGCGTTACACTGAAGCTAAGTTAAGCTTACTAGCTGAAGAGTTATTACGTG
ATATTAATAAAGAGACAGTTTCTTTCATTCCAAACTATGATGATACGACACTCGAACCAATGGTATTGCCATCAAGATTT
CCTAACTTACTAGTGAATGGTTCTACAGGTATATCTGCAGGTTACGCGACAGATATACCACCACATAATTTAGCTGAAGT
GATTCAAGCAACACTTAAATATATTGATAATCCGGATATTACAGTCAATCAATTAATGAAATATATTAAAGGTCCTGATT
TTCCAACTGGTGGTATTATTCAAGGTATTGATGGTATTAAAAAAGCTTATGAATCAGGTAAAGGTAGAATTATAGTTCGT
TCTAAAGTTGAAGAAGAAACTTTACGCAATGGACGTAAACAGTTAATTATTACTGAAATTCCATATGAAGTGAACAAAAG
TAGCTTAGTAAAACGTATCGATGAATTACGTGCTGACAAAAAAGTCGATGGTATCGTTGAAGTACGTGATGAAACTGATA
GAACTGGTTTACGAATAGCAATTGAATTGAAAAAAGATGTGAACAGTGAATCAATCAAAAATTATCTTTATAAAAACTCT
GATTTACAGATTTCATATAATTTCAACATGGTCGCTATTAGTGATGGTCGTCCAAAATTGATGGGTATTCGTCAAATTAT
AGATAGTTATTTGAATCATCAAATTGAGGTTGTTGCAAATAGAACGAAGTTTGAATTAGATAATGCTGAAAAACGTATGC
ATATCGTTGAAGGTTTGATTAAAGCGTTGTCAATTTTAGATAAAGTAATTGAATTGATTCGTAGCTCTAAAAACAAGCGT
GACGCTAAAGAAAACCTTATCGAAGTATTCGAGTTCACAGAAGAACAGGCTGAAGCAATTGTAATGTTACAGTTATATCG
TTTAACAAACACTGACATAGTTGCGCTTGAAGGTGAACATAAAGAACTTGAAGCATTAATCAAACAATTACGTCATATTC
TTGATAACCATGATGCATTATTGAATGTCATAAAAGAAGAATTGAATGAAATTAAAAAGAAATTCAAATCTGAACGACTG
TCTTTAATTGAAGCAGAAATTGAAGAAATTAAAATTGACAAAGAAGTTATGGTGCCTAGTGAAGAAGTTATTTTAAGTAT
GACACGTCATGGATATATTAAACGTACTTCTATTCGTAGCTTTAATGCTAGCGGTGTTGAGGATATTGGTTTAAAAGATG
GTGACAGTTTACTTAAACATCAAGAAGTAAATACGCAAGATACCGTACTAGTATTTACAAATAAAGGTCGTTATCTATTT
ATACCGGTTCATAAATTAGCAGATATTCGTTGGAAAGAATTGGGGCAACATGTATCACAAATAGTTCCTATCGAAGAAGA
TGAAGTGGTTATTAATGTCTTTAATGAAAAGGACTTTAATACAGATGCATTTTATGTTTTTGCGACTCAAAATGGCATGA
TTAAGAAAAGTACAGTGCCTCTATTTAAAACAACGCGTTTTAATAAACCTTTAATTGCTACTAAAGTTAAAGAAAATGAT
GATTTGATTAGTGTTATGCGCTTTGAAAAAGATCAATTAATTACCGTCATTACTAATAAAGGTATGTCATTAACGTATAA
TACAAGTGAACTATCAGATACCGGATTAAGGGCAGCTGGTGTTAAATCAATAAATCTTAAAGCTGAAGATTTCGTTGTTA
TGACAGAAGGTGTTTCTGAAAATGATACTATATTGATGGCCACACAACGCGGCTCGTTAAAACGTATTAGTTTTAAAATC
TTACAAGTTGCTAAAAGAGCACAACGTGGAATAACTTTATTAAAAGAATTAAAGAAAAATCCACATCGTATTGTAGCTGC
ACATGTAGTGACAGGTGAACATAGTCAATATACATTATATTCAAAATCAAATGAAGAACATGGTTTAATTAATGATATTC
ATAAATCTGAACAATATACAAATGGCTCATTCATTGTAGATACAGATGATTTTGGTGAAGTAATAGACATGTATATTAGC
TAA

>CARD|pvgb|AB003428.1|151-2416|ARO:3003702|Pseudomonas|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAGCGAATCCCTCGATCTGAGCCTGGAAGGGGTCGAACGCCGGTCGTTGGCCGAGTTCACCGAGCAGGCCTATCTGAA
CTATTCCATGTACGTGATCATGGACCGCGCCCTGCCGCATATCGGCGACGGCCTGAAACCGGTGCAGCGACGCATCGTCT
ACGCCATGAGCGAACTGGGGCTGGATGCCGATTCCAAGCACAAGAAGTCGGCGCGCACCGTCGGCGACGTGCTCGGCAAG
TTCCACCCGCACGGCGACTCGGCCTGCTACGAGGCCATGGTGCTGATGGCGCAGCCGTTCTCCTATCGCTATCCGCTGGT
GGACGGCCAGGGCAACTGGGGGGCTCCGGACGATCCCAAGTCCTTCGCCGCCATGCGTTATACCGAGGCGCGCCTGTCGC
GCTATTCCGAGGTGCTGCTCAGCGAACTGGGCCAGGGTACCGTGGACTGGGTACCGAACTTCGACGGCACCCTCGACGAG
CCGGCCGTGCTGCCGGCCCGCCTGCCCAACCTGCTGCTCAACGGCACCACCGGCATCGCGGTGGGCATGGCCACCGACGT
GCCGCCGCACAACCTGCGGGAAGTCGCGTCGGCCTGCGTGCGCCTGCTCGACCAGCCGGGCGCGACGGTCGCCGAATTGT
GCGAACACGTGCCGGGCCCGGACTTCCCCACCGAAGCCGAGATCATCACCCCGCGCGCCGACCTGCAGAAGGTCTACGAG
ACCGGCCGCGGTTCGGTGCGCATGCGCGCGGTGTACCGCTTCGAGGACGGCGATATCGTCATCCACGCCCTGCCGCACCA
GGTGTCCGGTTCCAAGGTGCTGGAACAGATCGCCGGGCAGATGCAGGCCAAGAAGCTGCCGATGGTGGCCGACCTGCGCG
ACGAGTCGGACCACGAGAACCCGACCCGCATCGTCATCATCCCGCGTTCGAACCGGGTCGATGTCGAAGAGCTGATGACC
CATCTGTTCGCCACCACCGACCTGGAGACCAGCTACCGGGTCAACCTGAACATCATCGGCCTCGACGGCAAGCCGGCAGT
CAAGGACCTGCGCCAGTTGCTCTCGGAGTGGCTGCAGTTCCGCATCGGCACCGTGCGTCGACGCCTGCAGTTCCGCCTGG
ACAAGGTCGAGCGCCGCCTGCATCTGCTGGATGGCTTGCTGATCGCCTTCCTCAACCTCGACGAGGTGATCCACATCATC
CGCACCGAGGACCAGCCCAAGGCGGTGCTGATGGAGCGCTTCGAACTCAGCGAGGTGCAGGCCGACTACATCCTCGACAC
CCGCCTGCGCCAGTTGGCACGCCTGGAAGAGATGAAGATCCGCGGCGAGCAGGAAGAGTTGCTGAAGGAGCAGAAGCGCC
TGCAGACCCTGCTCGGCAGCGAGGCCAAGCTGAAGAAGCTGGTGCGCGAGGAGCTGATCAAGGACGCCGAGACCTACGGC
GACGACCGCCGTTCGCCGATCGTCGCCCGCGCCGAGGCCCGCGCGCTGTCGGAAACCGAGCTGATGCCCACCGAACCGGT
GACCGTGGTGCTCTCGGAAAAAGGCTGGGTGCGTTGCGCCAAGGGCCACGACATCGACGCCGCCGGCCTCTCCTACAAGG
CCGGCGACGGCTTCAAGGCCGCCGCGCCGGGACGCTCGAACCAGTATGCGGTGTTCATCGACTCCACCGGGCGCAGCTAC
TCGCTGCCGGCCCACAGCCTGCCGTCCGCGCGAGGCCAGGGCGAGCCACTCAGCGGCCGGCTGACGCCGCCGCCGGGGGC
CAGCTTCGAATGCGTGCTGCTGCCGGACGACGATGCGCTGTTCGTGATCGCTTCCGACGCCGGCTATGGTTTCGTGGTCA
AGGGCGAGGACCTGCAGGCCAAGAACAAGGCCGGCAAGGCCCTGCTCAGCCTGCCCAACGGCTCCGCCGTGGTGGCGCCG
CGCCCGGTGCGCGATGTGGAGCAGGATTGGCTGGCGGCCGTGACGACCGAGGGCCGTCTGCTATTGTTCAAGGTCTCCGA
CCTGCCGCAGCTCGGCAAGGGCAAGGGCAACAAGATCATCGGCATCCCCGGCGAACGCGTGGCCAGCCGCGAGGAATACC
TCACCGACCTGGCTGTTCTGCCAGCCGGGGCGACGTTGGTCCTGCAGGCCGGAAAGCGTACCCTGTCGCTCAAGGGCGAC
GACCTGGAACACTACAAGGGGGAGCGAGGCCGGCGAGGCAACAAGCTGCCGCGCGGTTTCCAGCGCGTCGACAGCCTGCT
GGTGGATATTCCGCCACAGGATTGA

>Flq|FN543093.2|gene3588|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAGTGACTTAACTCACGATGGTGCAGAGCGCCTCGCGCTGCATGAATTCACGGAAAACGCCTATCTGAACTACTCCAT
GTACGTCATCATGGATCGCGCGCTGCCGTTTATCGGCGACGGGCTTAAGCCTGTTCAACGCCGCATCGTCTATGCCATGT
CGGAACTGGGGTTGAATGCCAGCGCCAAATTCAAAAAATCCGCCCGTACCGTGGGTGACGTGCTGGGTAAATATCACCCG
CACGGCGACAGCGCCTGCTATGAAGCGATGGTGCTGATGGCGCAGCCGTTCTCGTACCGTTACCCGCTGGTGGACGGGCA
GGGGAACTGGGGCGCGCCGGACGATCCGAAATCCTTCGCGGCGATGCGTTACACCGAATCGCGTCTCTCTAAATATGCCG
AAGTGCTGCTGGGCGAGCTGGGCCAGGGCACTGTGGATTATGTCCCGAACTTCGACGGGACGCTGAACGAGCCGAAAATG
CTGCCGGCGCGCCTGCCGAACATTCTGCTGAACGGCACCACGGGCATCGCGGTGGGTATGGCGACGGATATTCCGCCGCA
CAACCTGCGTGAAGTGGCTAAAGCGGCCGTCAGCCTTATCGACAGCCCGAAAACCACGCTTGATGAACTGCTGGATATCG
TGCAGGGCCCGGATTACCCGACCGAAGCGGAAATCATTACCTCCCGCGCTGAAATCCGCAAAATCTACCAGAGCGGCCGC
GGCTCGGTGCGTATGCGCGCCGTGTGGAAGAAAGAAGACGGCGCGGTGGTTATTTCCGCGCTGCCGCATCAGGTGTCCGG
CGCCCGCGTGCTGGAGCAGATTGCAAGCCAGATGCGCGCCAAAAAGCTGCCGATGGTCGATGACCTGCGCGATGAGTCCG
ATCACGAGAACCCGACGCGTCTGGTTATCGTGCCGCGCTCTAACCGCGTGGATATGGATCAGGTGATGAACCACCTGTTC
GCCACCACCGATCTGGAAAAAAGCTACCGCATTAACCTCAACATGATTGGGCTTGATGGCCGCCCGGCGGTGAAAAACCT
GCTGGAGATCCTCACCGAATGGCTGGTGTTCCGTCGCGATACGGTGCGCCGCCGTCTGAACTATCGCCTCGATAAAGTCA
TGCGTCGCCTGCATATCCTGGAAGGTTTGCTGGTCGCGTTCCTCAATATCGACGAAGTGATTGAGATTATCCGCGGCGAA
GATGAGCCGAAGCCGGTGCTGATGAGCCGTTTCGGCATCAGCGAAACGCAGGCGGAAGCTATCCTCGAACTTAAACTGCG
CCATCTCGCGAAGCTTGAAGAGATGAAGATCCGCGGCGAGCAGAGCGATCTGGAAAAAGAACGCGATCAGCTCCAGGGCA
TTCTCGCCTCCGAGCGCAAAATGAATACTCTCCTGAAAAAAGAGATCCAGGCGGATGCCGACGCGTACGGCGACGATCGC
CGCTCGCCGCTGCATGAGCGTGAAGAAGCGAAAGCGATGAGCGAGCATGACATGTTGCCGTCCGAGCCGGTCACTATCGT
ACTCTCCCAGATGGGCTGGGTGCGCAGCGCCAAAGGCCACGACATCGACGCCAAAGCGCTGAGTTATAAAGCAGGCGACA
ACTGGCTCTCGTCAGCGAAAGGCAAAACCAACCAGCCGGTGGTGTTTATCGACTCCACGGGCCGCAGCTACGCGCTGGAT
CCGGTATCGCTGCCGTCGGCGCGCGGTCAGGGCGAGCCGCTTACCGGCAAACTGACGCTGCCGCCAGGCGCGGTAGTGGA
ACATATGCTGATGACCGGCGAAGATCAGAAGCTCCTGATGGCCTCTGACGCGGGTTACGGTTTTGTCTGCACCTTCAACG
ATCTGGTGGCGCGCAACCGCGCCGGTAAAGCGCTGATTACGCTGCCGGAAAACGCGCATGTGCTCAAACCGCTGGAAATT
GAACATGACGACGATATGCTGCTCGCCATTACGGCGGCGGGGCGTATGCTGATGTTCCCGGTGGCCGATCTCCCGCAGCT
CTCCAAAGGCAAGGGCAACAAAATTATCTCGATTCCTTCCGCCGATGCGGCGAAGGGCGACGATAAGCTTGCCTATCTCA
CCATCCTGCCGCCGCAGAGCACCGTGACGCTGCATGTCGGCAAGCGCAAGATCAAACTGCGCCCGGAAGAGTTGCAAAAA
GTGCATGGCGAACGCGGGCGTCGCGGTACGCTGATGCGCGGCTTACAACGCATCGACAGCGTCGAAGTGGACGCCCCGTC
GCGCCCGAAAGCTGACGACGGCGAGGCGTAA

>Flq|CP002695.1|gene1275|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAGCGACAGCAATCAACCGGGCCTGTTCGACGGTGGCGCCACCGATCCCCACGAAGCCATCACCCTGGGCCGCTATGC
CGAGCAGGCCTACCTGGACTACGCCGTGTCCGTGGTGCGCGGCCGCGCCCTGCCCGATGTGGGCGACGGCCAGAAACCGG
TGCAGCGCCGCATCCTGTACGCGATGCAGGCCATGGGGCTGGCGGCAGGCGCCAAGCCGGTGAAGTCGGCGCGCGTGGTC
GGCGACGTGCTGGGCAAGTACCACCCGCACGGCGACCAGGCCGCCTATGACGCCATGGTCCGGATGGCGCAGGACTTCTC
GCTGCGCTATCCCCTGATCGACGGCCATGGCAACTTCGGCTCGCGCGACGGCGACAACGCGGCGGCCATGCGTTATACCG
AAGCGCGCCTGACGCCGTTCTCCAAGCTGCTGCTCGACGAGCTGGAGGAGGGCACGGTCGACTTCGTGCCGAACTACGAC
GGCAGCCAGCAGGAGCCGGCCATGCTGCCGGCGCGCCTGCCCGTGATGCTGCTCAACGGCGCCTCGGGCATCGCCGTGGG
CATGGCCACCGAGATTCCCTCGCACAACCTGCGCGAGGTGGCGCAGGCCTGCGTGGCGCTGATCCGCAATCCCAAGCTGC
CGCAGGAAGAGCTGCTGGCGCTGGTGCCGGGCCCGGATTTCGCCGGGGGCGGCCAGATCATCACCCCGGCGGCCGATATC
GCGCAGATCTACGCCACCGGGCGCGGCTCGCTGAAGGCGCGCGCGCGCTGGCAGTTCGAGGAAATGGCGCGCGGGCAGTG
GCAGCTGGTGGTGACCGAGCTGCCGCCGGGCACCTCGGGCCAGAAGGTGCTGGAAGAGATCGAGGAAATCACCAATCCGA
AGGTGCGCGCGGGCAAGAAGAGCCTTTCGGCCGAGCAGCAGCAGGCCAAGGCGGTCATGCTCAGCCTGCTCGACGCGGTG
CGCGACGAGTCCGGCAAGGACGCGGCGGTGCGGCTGGTGTTCGAGCCCAAGACCTCGCGCGTCGATCGCGACGAATTCGT
CAACACCTTGCTGGCGCAGACCAGCATGGAAAGCAACGTGCCGGTCAACGTGGTGTGCATCGGCACCGATGGCCGGCCGC
GCCAGAAGAGCCTGCGCGACGTGCTGGAAGAGTGGGTGGCGTTTCGCACCGATACGGTGGTGCGCCGCACGCGCCATCGC
CTGGACAAGGTGCTCGACCGCATCCATGTGCTGGAAGGGCGCATGGTGGTCTACCTCAATGTCGACGAGGTCATCCAGAC
CATTCGCGAGGCCGAGGAGCCGCGCGCCGCGCTGATGGCGCGTTTCGGGCTGACCGAGCGCCAGGCCGAGGACATCCTGG
AAATGCGCCTGCGCCAGCTGGCGCGCCTGGAAGGCATCAAGATCGAACAGGAACTGGCCGGCAAGCGCGAAGAACAGCTG
CGCCTGCAGGACCTGCTGGACAACCCGGGCTCGCTCAAGCGCCTGCTCATCAAGGAAATCGAGGGCGACGCCAAGCAGTA
CGGCGACGACCGCCGCACCCTGATCGAAACCGCCGAGCGCGCGGTGCTCGAGACCAAGGTGGTCGACGAGCCCGTCACGG
TGATCGTGTCGCAGAAAGGCTGGCTGCGCGCCCGCCAGGGCCACGGCCATGATGCCGGGCAATTCAGCTTCAAGCAGGGC
GACGACCTGTACGGCGCCTTCGAGTGCCGCACCACCGATACCCTGATCGCGGTGGGCGACAACGGCCGCGTCTATTCGGT
GGCCGTATCCGGCCTGCCGTCGGCGCGTGGCGATGGCCAGCCGGTCACCACCATGATCGATCTCGAGGCCGGCACGCGCA
TCGTGCACACCATCGCGGCGGCGCCCGACAGCCGCTGGTTGTTGGCCACGCGGCGCGGCTTCGGTTTTGCCGCCCGGCTC
AGCGACATGAGCAGCCGCCAGCGCGCTGGCAAGCAGTTCATCACCCTGGAGAAGGGCGATGAGCTGTTGCGGCCGGTTCC
GCTGTTCGAGGGGGCGACCCAGCTGGCGCTGCTGTCGGCCAAGGGCAAGTTCCTGGTGTTCGACCTGGACGAGGTCAAGA
GCCTGTCGGGCGGCGGGCGCGGCACCATCCTGATGGGGCTGGACACCGCCGACAAGCTGGACCAGACCGTGCCGATCGGC
GCGGCCGGCCTGCGCGCCGCCGGCATCTACCGCAACAAGCAGACCGAGGACATCCTGGCCGGCGCCGCGCTCGCGCCGTA
CGTCGGCAAGCGCGCCCGCAAGGGCCGGCAACTGAACGTGCGTCCCAGGCAGCCGGTGCTGTCGCCGGTGTTCTGA

>CARD|pvgb|AE005672|800699-803171|ARO:3003311|Streptococcus|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGTCTAACATTCAAAACATGTCCCTGGAGGACATCATGGGAGAGCGCTTTGGTCGCTACTCCAAGTACATTATTCAAGA
CCGGGCTTTGCCAGATATTCGTGATGGGTTGAAGCCGGTTCAGCGCCGTATTCTTTATTCTATGAATAAGGATAGCAATA
CTTTTGACAAGAGCTACCGTAAGTCGGCCAAGTCAGTCGGGAACATCATGGGGAATTTCCACCCACACGGGGATTCTTCT
ATCTATGATGCCATGGTTCGTATGTCACAGAACTGGAAAAATCGTGAGATTCTAGTTGAAATGCACGGTAATAACGGTTC
TATGGACGGAGATCCTCCTGCGGCTATGCGTTATACTGAGGCACGTTTGTCTGAAATTGCAGGCTACCTTCTTCAGGATA
TCGAGAAAAAGACAGTTCCTTTTGCATGGAACTTTGACGATACGGAGAAAGAACCAACGGTCTTGCCAGCAGCCTTTCCA
AACCTCTTGGTCAATGGTTCGACTGGGATTTCGGCTGGTTATGCCACAGACATTCCTCCCCATAATTTAGCTGAGGTCAT
AGATGCTGCAGTTTACATGATTGACCACCCAACTGCAAAGATTGATAAACTCATGGAATTCTTGCCTGGACCAGACTTCC
CTACAGGGGCTATTATTCAGGGTCGTGATGAAATCAAGAAAGCTTATGAGACTGGGAAAGGGCGCGTGGTTGTTCGTTCC
AAGACTGAAATTGAAAAGCTAAAAGGTGGTAAGGAACAAATCGTTATTATTGAGATTCCTTATGAAATCAATAAGGCCAA
TCTAGTCAAGAAAATCGATGATGTTCGTGTTAATAACAAGGTAGCTGGGATTGCTGAGGTTCGTGATGAGTCTGACCGTG
ATGGTCTTCGTATCGCTATCGAACTTAAGAAAGACGCTAATACTGAGCTTGTTCTCAACTACTTATTTAAGTACACCGAC
CTACAAATCAACTACAACTTTAATATGGTGGCGATTGACAATTTCACACCTCGTCAGGTTGGGATTGTTCCAATCCTGTC
TAGCTATATCGCTCACCGTCGAGAAGTGATTTTGGCGCGTTCACGCTTTGACAAAGAAAAGGCTGAGAAACGTCTCCATA
TCGTCGAAGGTTTGATTCGTGTGATTTCGATTTTGGATGAAGTCATTGCTCTTATCCGTGCTTCTGAGAATAAGGCGGAC
GCCAAGGAAAACCTCAAAGTTAGCTATGATTTTACGGAAGAACAGGCTGAGGCTATCGTAACTTTGCAACTGTACCGTTT
GACCAATACCGATGTGGTTGTCTTGCAGGAAGAAGAAGCAGAGCTTCGTGAGAAGATTGCTATGCTGGCGGCTATTATCG
GTGATGAAAGGACTATGTACAATCTCATGAAGAAAGAACTTCGTGAGGTCAAGAAGAAATTTGCAACTCCTCGTTTGAGT
TCTTTAGAAGACACTGCGAAAGCAATTGAGATTGATACAGCTAGTCTTATCGCTGAGGAAGATACCTACGTCAGCGTGAC
CAAGGCAGGTTACATCAAGCGTACCAGTCCACGTTCCTTTGCGGCTTCCACCTTGGAAGAAATTGGCAAGCGTGATGATG
ACCGTTTGATTTTTGTTCAATCTGCCAAGACAACCCAGCACCTCTTGATGTTCACAAGTCTTGGAAATGTCATCTACAGA
CCAATCCATGAGTTGGCAGATATTCGTTGGAAGGACATCGGAGAGCATCTGAGCCAAACCATCACAAACTTTGAAACGAA
TGAAGAAATCCTTTATGTGGAAGTACTGGATCAGTTTGACGATGCGACAACCTACTTTGCAGTGACTCGCCTTGGTCAAA
TCAAACGGGTAGAGCGAAAAGAATTCACTCCATGGCGGACCTATAGATCTAAGTCTGTCAAGTATGCTAAGCTCAAAGAC
GATACAGATCAGATTGTAGCAGTGGCTCCGATTAAACTAGATGATGTTGTCTTGGTTAGTCAAAATGGTTATGCCCTGCG
TTTCAATATCGAAGAGGTTCCGGTTGTCGGTGCTAAGGCAGCAGGTGTCAAGGCTATGAATTTGAAAGAAGATGATGTCC
TCCAATCTGGCTTTATCTGTAATACTTCGTCCTTCTACCTCTTGACCCAGCGTGGAAGCTTGAAACGTGTTTCCATTGAG
GAAATTCTAGCAACCAGCCGTGCCAAACGAGGATTACAAGTCTTGCGTGAGTTGAAAAACAAACCGCATCGTGTCTTCTT
GGCAGGAGCAGTTGCAGAGCAAGGATTTGTTGGCGATTTCTTCAGTACGGAAGTGGATGTGAACGACCAAACTCTGCTTG
TCCAATCCAATAAAGGAACAATCTATGAAAGCCGATTGCAAGACTTGAACTTGTCAGAACGCACTAGCAATGGAAGCTTC
ATTTCTGACACGATTTCAGATGAAGAAGTTTTTGACGCTTATCTTCAGGAAGTAGTTACTGAAGATAAATAAG

>Flq|CP004022.1|gene2480|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAGTGAACTGACTCATGATGGTGTAGAGCGCCAACCGCTCCACTTATTTACGGAAAATGCCTATCTCAATTACTCAAT
GTACGTGATTATGGATCGTGCATTGCCTTTTATTGGCGATGGGTTAAAACCAGTACAGCGTCGTATCGTCTATGCGATGT
CTGAATTAGGTTTAAACAGCAGTGCTAAATTTAAAAAATCAGCACGAACAGTGGGGGATGTATTAGGTAAATATCATCCC
CACGGTGATAGCGCCTGTTATGAAGCCATGGTATTGATGGCGCAACCCTTCTCTTATCGTTATCCATTAATTGATGGGCA
AGGTAACTGGGGGGCTCCGGATGATCCTAAATCTTTCGCAGCTATGCGTTATACCGAGTCTCGCTTATCTAAATATTCAC
AGATCCTGCTAAGCGAATTGGGACATGGTACTGTTGATTGGATCCCCAATTTTGATGGCACCCTGCAAGAGCCAAAAATG
TTGCCTGCTCGTTTACCTAATATTTTATTAAATGGGACAACGGGGATTGCTGTCGGTATGGCAACGGATATTCCGCCACA
TAATGCGCGGGAAATCGGCCAAGCATTAACCATGCTATTAGATAATCCTGATGCTGGGTTATCTGATGTTATGCAATATG
TACAAGGACCTGATTATCCAACAGAAGCGGAAGTGATCACCGCTCCTGAGGATATCAAAAAGATTTATAAAACAGGACGT
GGTTCTATTAGAATGCGTGCTGTTTGGCAAAAAGAAGAGGGTTGTGCGGTGATAACAGCTCTCCCTCATCAAGTCTCTGG
TGCTAAGGTACTTGAACAAATTGCTGCATTAATGCGAGCGAAAAAATTGCCTTTAGTTGATGATTTACGTGATGAGTCAG
ATCATGAAAATCCTACTCGATTGGTAATTGTTCCTCGTAGTAATCGTGTCGATTTAGAACAAGTCATGTATTACTTATTT
GTAAATACAGACTTAGAGAAAAGTTATCGCGTTAACCTCAATATGATTGGGTTAGATAACCGTCCTGCTGTGAAAGGGCT
ATTAACCATTTTAAATGAGTGGTTAGTTTATCGCCGTCAAACCGTAACCAATCGTTTAAACCATCGCTTAGAAAAAGTAT
TACGCCGTTTAGAAATTCTAAAAGGTTTATTAATCGCTTATCTCAATATTGATGAAGTGATTGAGATCATCCGTTATGAA
GATGAGCCAAAAGCCGAATTAATGCGTCGTTTTGCATTATCAGATATTCAAGCAGAAGCGATTTTAGAGTTACGTTTACG
TCACTTAGCTAAGCTTGAAGAGATAAAACTGCAAGCTGAAAGTGATGAACTGGAAAAAGAGCGCGACAGTATTGAAAAAC
TGTTAAATTCTCCTCGCCGTCTCAATACGTTATTGAAAAAAGAGATAGAGGCAGACGCTAAAGAGTTTGGTGATGAACGA
CGTTCTCCTATTCGACCTCAAGAAGAGGCGAAAGTGGTTAATGAACAAGATATGTTGCCATCAGAGCCTGTGACTATTGT
GCTTTCTGAAATGGGATGGGTGCGTAGTGCGAAAGGGCACGAAATTGATCCTAGTACCATGAGTTATCGTGCCGGAGACA
GTTATCATAGTGCGGTACGGGGTATGAGCAACCAGCCAGTATTGTTCCTTGATTCAACGGGTAGAAGCTATAGTTTAAGT
CCCAATGACATGCCATCAGGCCGTAGCCAAGGTGAGCCTTTAACCGGTAAATTGACCTTCCCACCTGACGCCAGCGTAAA
ATATATGTTAGCGGGAGCCGCTAAACAGGAGTATTTACTGGCAACGAAAGAGGGTTATGGCTCCGTACTCAGTTATGAAG
AAATGGAGACAAAAAATAAAACCGGTAAAGGGTTGTTAACGGTTTCAGATGAAACAGAATTGCTAGCGCCTTTCTTAGTC
GATGCAGAAAAGAAAAACAATCAACATTGGTTAGTTATTATCACCGATAAAACACGTATTCTGGCGATATCTGCAGAACA
TCTAAATGAGATGAATAAGAAAGGTCGAGGCACTCGCTTAGTTACATTAGGCAAAGAGCAAAGTGATGTTATCGAACAAA
TCGTGTTAATAGCAAAAAATGAAGCCCTCACTTTTACTGTTGATGGTCAACAACAAACATTAAAAGCAGAAGAGATTAGC
TATTTTAGTGGTGATGTTGGCGATGAGCCTATCCCATTAAAACATCTTCACCCTGAAGCGGTTACCGTGATCATGTCCGA
AAAAGGGCTTATCCGTTGCCAAAAAGGCCATAACATTGATGCGAAATCAGTGGGCTTTAAGACAGGGGATGATTATTTTG
ATGCAGTTGAAGGGATGAGCAATCAAGCGGTACATCTGATTGATACCACGGGTCAAAGTTATACTGTTGATGTTGACGCA
TTACCATCAGGCCGTAGTAAAGGTGATGATTTAACAGGACGATTAAAAGTCCAAAAAGGGGCTCAATTACGTCATGTAGT
GATGGGGGAAAGTAGCGATAAGATCTTAATGGCATCCGACGCTGGTTATGGGTTTATCTGTAGTATTGATGACTTAACCT
CTAAAAATAGAGCTGGTAAATCATTATTAACATTACCTGAAAATGCATTACCATTACCACCTCAACGCTTAAATGATGAA
TTGAGTGATTTGATCATGATCATTACTCAGGGTGGGCGAATGCTGATTTTTGAAGCCTCTGAGTTGCCAACTATGGTAAA
AGGAAAAGGTAACCAAATGGTTTCTATTCCTGCTTCACAGGCTGCAAGTGGTGAAGATAAAGTCGCTTGGTTACGGGTAT
TACCAGAAAATGCCAGTGTTACATTGCATTTTGGTAAACGTAAACTCACGATGTCGATGAATGAATTACAGACATTTAAA
GCCAAACGTGGTCGTCGTGGAACATCGCTCCCTCGTGGTGCACAAAGTATCGATCATATAGATATCGAAACTCATTAA

>Flq|NC_010410.6003198|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGACCAGCCTTGCGCATCATGCGACAGAAAACCGCTCTGTAGCCGAATTTACTGAACAGGCTTACTTGAATTATGCCAT
GTACGTCATTATGGACCGTGCATTACCGCATATCAGTGATGGCTTAAAGCCCGTACAGCGCCGTATTGTCTATGCCATGA
GCGAGCTAGGCTTAAAAAGCAGTGGCAAGCCAAAAAAATCAGCGCGTACAGTGGGTGATGTACTTGGTAAATACCACCCA
CATGGTGACTTGGCATGTTATGAAGCCATGGTACTCATGGCTCAGCCATTTAGTTACCGCTATCCTTTAATCGAAGGTCA
GGGGAACTGGGGCTCACCTGATGATCCTAAGTCTTTTGCTGCGATGCGTTATACCGAAGCAAAACTCTCGGCTTATAGTG
AATTATTGCTGAGCGAATTAGGTCAGGGCACTAGCGAATGGCAAGATAACTTTGATGGTTCTTTAAAAGAACCGATCACT
TTACCTGCGCGTGTACCTAATATTCTTCTTAATGGTACGACAGGTATTGCTGTTGGGATGGCAACTGATATCCCGCCACA
TAATTTGCGTGAAGTTGTAAAAGGCACAATTGCTTTAATCCGTAATCCGCAAACCTCGGACGAAAAATTAGCTGAATATA
TTCCGGCTCCGGATTTACCAACCAAAGCTGAAATTATTACCCCGCCAGAAGAATTACTCAAAATCCAGACCACTGGTCGT
GGTAGTTATCGTATGCGAGCGGTATATACCATTGAGAAAAATGAAATTGTAATTACTGAGCTGCCATATCAAGTCTCTGG
TTCTAAGGTAATTACTCAAATTGCTGACCAGATGCAGGCTAAAAAGCTGCCATTAGTTGTCGACGTGCGTGATGAATCGG
ATCATGAAAACCCGACACGACTCGTGATTGTACTGCGCTCTAACCGTATTGATGCGGAAGCAGTGATGAGCCACTTATTT
GCGACCACCGATTTAGAATCAAGCTATCGTGTCAATTTGAACATGATTGGCGAAGATGGCCGTCCTCAGGTGAAATCAAT
TCGTCGTATTTTGCTTGAATGGATCGAGATCCGTAAAAAAACGGTAACTCGTCGTTTGCAGTACCATTTAAACCGTATTG
AAAAGCGCCTGCATATTTTGGCAGGTCTTTTAATTGCTTATCTCGATATTGATACAGTCATTCGTATTATTCGTGAAGAA
GACCAGCCTAAGCCAGTCTTGATGGAACACTTTAATATTGATGAGATACAGGCCGAGGCGATTTTAGAGCTTAAATTACG
TCATTTGGCAAAGCTTGAAGAGATGGAAATCCGTCATGAACAAGATGAACTTTCTGCGAAAGCTGCCATTATTCGTGAAC
AACTCGAAAATCCTGAATCTTTAAAAAACCTAATTATCAGTGAATTAAAAGAAGATGCGAAAAAGTTCGGTGATGAGCGC
CGTTCTCCAATTGTTGCACGTGCTGAAGCAGTTCAAATTAAAGAACAGGATTTAATGCCAGCTGAAACGGTAACGGTGGT
TTTGTCTGAAGCAGGCTGGGTTCGTGCGGCAAAAGGTGCGGATGTGGATGCCGAAAATCTCAACTACCGTGCTGGGGACC
AATATTTAAGTCATGCTGTCGGGAAAACCAATCAGCGAGTTTACTTCCTTGATGAAACAGGGCGCAGCTATGCCTTGCCA
ATTAGTAACTTACCTTCAGCGAGAGGCTTGGGGGATCCATTAAGTTCTAAATTATCACCAGCAAGTGGCGTATCGTTTAT
TCAGGTTTATTTAGATGATGATGAGTCTGAATTGATTGCTGCAAGTTCGGCAGGTTATGGTTTTAAAACGCAAACCAAGC
AATTAGATACCAATGCGAAAGCCGGTAAGACATTCTTAACGGTTCCGGATAAGGCAAAGGCTTTACCACTCATTTCTGCC
CAAAACATGACGCATTTGGCTGTACTGAGCTCAGCAGGGCGTTTGTTAATTTTAGATTTGGCAGAACTACCAAATTTAAA
TAAAGGTAAAGGTAATAAGTTGATACAACTTGAAGGCAAAGAGCAAATTTTATCCATGACAACCCTGAACTTAGATGAAA
TAATTCAGGTGGTTGCAGGTCAACAACATCTCAAATTAAAAGGTGATGATCTACAAAAATACATGGGTAAACGTGCTTCG
AAAGGTCAGCTCTTACCACGTGGATATCAAAAAGCAAATAAACTGTTGATTCAGAGATAA

>Flq|NC_002516.2.879741|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAGCGAATCCCTCGATCTGAGCCTGGAAGGGGTCGAACGCCGGTCGTTGGCCGAGTTCACCGAGCAGGCCTATCTGAA
CTATTCCATGTACGTGATCATGGACCGCGCCCTGCCGCATATCGGCGACGGCCTGAAACCGGTGCAGCGACGCATCGTCT
ACGCCATGAGCGAACTGGGGCTGGATGCCGATTCCAAGCACAAGAAGTCGGCGCGCACCGTCGGCGACGTGCTCGGCAAG
TTCCACCCGCACGGCGACTCGGCCTGCTACGAGGCCATGGTGCTGATGGCGCAGCCGTTCTCCTATCGCTATCCGCTGGT
GGACGGCCAGGGCAACTGGGGGGCTCCGGACGATCCCAAGTCCTTCGCCGCCATGCGTTATACCGAGGCGCGCCTGTCGC
GCTATTCCGAGGTGCTGCTCAGCGAACTGGGCCAGGGTACCGTGGACTGGGTACCGAACTTCGACGGCACCCTCGACGAG
CCGGCCGTGCTGCCGGCCCGCCTGCCCAACCTGCTGCTCAACGGCACCACCGGCATCGCGGTGGGCATGGCCACCGACGT
GCCGCCGCACAACCTGCGGGAAGTCGCGTCGGCCTGCGTGCGCCTGCTCGACCAGCCGGGCGCGACGGTCGCCGAATTGT
GCGAACACGTGCCGGGCCCGGACTTCCCCACCGAAGCCGAGATCATCACCCCGCGCGCCGACCTGCAGAAGGTCTACGAG
ACCGGCCGCGGTTCGGTGCGCATGCGCGCGGTGTACCGCGTCGAGGACGGCGATATCGTCATCCACGCCCTGCCGCACCA
GGTGTCCGGTTCCAAGGTGCTGGAACAGATCGCCGGGCAGATGCAGGCCAAGAAGCTGCCGATGGTGGCCGACCTGCGCG
ACGAGTCGGACCACGAGAACCCGACCCGCATCGTCATCATCCCGCGTTCGAACCGGGTCGATGTCGAAGAGCTGATGACC
CATCTGTTCGCCACCACCGACCTGGAGACCAGCTACCGGGTCAACCTGAACATCATCGGCCTCGACGGCAAGCCGCAGGT
CAAGGACCTGCGCCAGTTGCTCTCGGAGTGGCTGCAGTTCCGCATCGGCACCGTGCGTCGACGCCTGCAGTTCCGCCTGG
ACAAGGTCGAGCGCCGCCTGCATCTGCTGGATGGCTTGCTGATCGCCTTCCTCAACCTCGACGAGGTGATCCACATCATC
CGCACCGAGGACCAGCCCAAGGCGGTGCTGATGGAGCGCTTCGAACTCAGCGAGGTGCAGGCCGACTACATCCTCGACAC
CCGCCTGCGCCAGTTGGCACGCCTGGAAGAGATGAAGATCCGCGGCGAGCAGGAAGAGTTGCTGAAGGAGCAGAAGCGCC
TGCAGACCCTGCTCGGCAGCGAGGCCAAGCTGAAGAAGCTGGTGCGCGAGGAGCTGATCAAGGACGCCGAGACCTACGGC
GACGACCGCCGTTCGCCGATCGTCGCCCGCGCCGAGGCCCGCGCGCTGTCGGAAACCGAGCTGATGCCCACCGAACCGGT
GACCGTGGTGCTCTCGGAAAAAGGCTGGGTGCGTTGCGCCAAGGGCCACGACATCGACGCCGCCGGCCTCTCCTACAAGG
CCGGCGACGGCTTCAAGGCCGCCGCGCCGGGACGCTCGAACCAGTATGCGGTGTTCATCGACTCCACCGGGCGCAGCTAC
TCGCTGCCGGCCCACAGCCTGCCGTCCGCGCGAGGCCAGGGCGAGCCACTCAGCGGCCGGCTGACGCCGCCGCCGGGGGC
CAGCTTCGAATGCGTGCTGCTGCCGGACGACGATGCGCTGTTCGTGATCGCTTCCGACGCCGGCTATGGTTTCGTGGTCA
AGGGCGAGGACCTGCAGGCCAAGAACAAGGCCGGCAAGGCCCTGCTCAGCCTGCCCAACGGCTCCGCCGTGGTGGCGCCG
CGCCCGGTGCGCGATGTGGAGCAGGATTGGCTGGCGGCCGTGACGACCGAGGGCCGTCTGCTATTGTTCAAGGTCTCCGA
CCTGCCGCAGCTCGGCAAGGGCAAGGGCAACAAGATCATCGGCATCCCCGGCGAACGCGTGGCCAGCCGCGAGGAATACC
TCACCGACCTGGCTGTTCTGCCAGCCGGGGCGACGTTGGTCCTGCAGGCCGGAAAGCGTACCCTGTCGCTCAAGGGCGAC
GACCTGGAACACTACAAGGGGGAGCGAGGCCGGCGAGGCAACAAGCTGCCGCGCGGTTTCCAGCGCGTCGACAGCCTGCT
GGTGGATATTCCGCCACAGGATTGA

>CARD|pvgb|NC_002952|1419759-1422162|ARO:3003312|Staphylococcus|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
GTGAGTGAAATAATTCAAGATTTATCACTTGAAGATGTTTTAGGTGATCGCTTTGGAAGATATAGTAAATATATTATTCA
AGAGCGTGCATTGCCAGATGTTCGTGATGGTTTAAAACCAGTACAACGTCGTATTTTATATGCAATGTATTCAAGTGGTA
ATACACACGATAAAAATTTCCGTAAAAGTGCGAAAACAGTCGGTGATGTTATTGGTCAATATCATCCACATGGAGACTTC
TCAGTGTACGAAGCAATGGTCCGTTTAAGTCAAGACTGGAAGTTACGACATGTCTTAATAGAAATGCATGGTAATAATGG
TAGTATCGATAATGATCCACCAGCGGCAATGCGTTACACTGAAGCTAAGTTAAGCTTACTAGCTGAAGAGTTATTACGTG
ATATTAATAAAGAGACAGTTTCCTTCATTTCAAACTATGATGATACGACGCTCGAACCAATGGTATTGCCATCAAGATTT
CCTAACTTACTAGTGAATGGTTCTACAGGTATATCTGCAGGTTACGCGACAGATATACCACCACATAATTTAGCTGAAGT
GATTCAAGCAACACTTAAATATATTGATAATCCGGATATTACAGTCAATCAATTAATGAAATATATTAAAGGTCCTGATT
TTCCAACTGGCGGTATTATTCAAGGTATTGATGGTATTAAAAAAGCTTATGAATCAGGTAAAGGTAGAATTATAGTTCGT
TCTAAAGTTGAAGAAGAAACTTTACGCAATGGACGTAAACAGTTAATTATTACTGAAATTCCATATGAAGTGAACAAAAG
TAGCTTAGTAAAACGTATCGATGAATTACGTGCTGACAAAAAAGTCGATGGTATCGTTGAAGTACGTGATGAAACTGATA
GAACTGGTTTACGAATAGCAATTGAATTGAAAAAAGATGTGAACAGTGAATCAATCAAAAATTATCTTTATAAAAACTCT
GATTTACAGATTTCATATAATTTCAACATGGTCGCTATTAGTGATGGTCGTCCAAAATTGATGGGTATTCGTCAAATTAT
AGATAGTTATTTAAATCATCAAATTGAGGTTGTTGCAAATAGAACGAAGTTTGAATTAGATAATGCTGAAAAACGCATGC
ATATCGTTGAAGGTTTGATTAAAGCGTTGTCAATTTTAGATAAAGTAATCGAATTGATTCGTAGCTCTAAAAACAAGCGT
GACGCTAAAGAAAACCTTATCGAAGTATACGAGTTCACAGAAGAACAGGCTGAAGCAATTGTAATGTTACAGTTATATCG
TTTAACAAACACTGACATAGTTGCGCTTGAAGGTGAACATAAAGAACTTGAAGCATTAATCAAACAATTACGTCATATTC
TTGATAACCATGATGCATTATTGAATGTCATCAAAGAAGAATTGAATGAAATTAAAAAGAAATTCAAATCTGAACGACTG
TCTTTAATTGAAGCAGAAATTGAAGAAATTAAAATTGACAAAGAAGTTATGGTGCCTAGTGAAGAAGTTATTTTAAGTAT
GACACGTCATGGATATATTAAACGTACTTCTATTCGTAGCTATAATGCTAGCGGTGTTGAAGATATTGGTTTAAAAGATG
GTGACAGTTTACTTAAACATCAAGAAGTAAATACGCAAGATACCGTACTAGTATTTACAAATAAAGGTCGTTATCTATTT
ATACCGGTTCATAAATTAGCAGATATTCGTTGGAAAGAATTGGGGCAACATGTATCACAAATAGTTCCTATCGAAGAAGA
TGAAGTGGTTATTAATGTCTTTAATGAAAAGGACTTTAATACAGATGCATTTTATGTTTTTGCGACTCAAAATGGCATGA
TTAAGAAAAGTACAGTGCCTCTATTTAAAACAACGCGTTTTAATAAACCTTTAATTGCTACTAAAGTTAAAGAAAATGAT
GATTTGATTAGTGTTATGCGCTTTGAAAAAGATCAATTAATTACCATCATTACAAATAAAGGTATGTCTTTAACTTATAA
TACAAGTGAACTATCAGATACCGGATTAAGGGCAGCTGGTGTTAAATCAATAAATCTTAAAGCAGAAGATTTCGTTGTTA
TGACAGAAGGTGTTTCTGAAAATGATACTATATTGATGGCCACACAACGCGGCTCGTTAAAACGTATTAGTTTTAAAATC
TTACAAGTTGCTAAAAGAGCACAACGTGGAATAACTTTATTAAAAGAATTAAAGAAAAATCCACATCGTATAGTAGCTGC
ACATGTAGTGACAGGTGAACATAGTCAATATACATTATATTCAAAATCAAACGAAGAACATGGTTTAATTAATGATATTC
ATAAATCTGAACAATATACAAATGGCTCATTCATTGTAGATACCGATGATTTTGGTGAAGTAATAGACATGTATATTAGC
TAAA

>Flq|CP000034.1|gene3218|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAGCGATATGGCAGAGCGCCTTGCGCTACATGAATTTACGGAAAACGCCTACTTAAACTACTCCATGTACGTGATCAT
GGACCGTGCGTTGCCGTTTATTGGTGATGGTCTGAAACCTGTTCAGCGCCGCATTGTGTATGCGATGTCTGAACTGGGCC
TGAATGCCAGCGCCAAATTTAAAAAATCGGCCCGTACCGTCGGTGACGTACTGGGTAAATACCATCCGCACGGCGATAGC
GCCTGTTATGAAGCGATGGTCCTGATGGCGCAGCCGTTCTCTTACCGTTATCCGCTGGTTGATGGTCAGGGGAACTGGGG
CGCGCCGGACGATCCGAAATCGTTCGCGGCAATGCGTTACACCGAATCCCGGTTGTCGAAATATTCCGAGCTGCTATTGA
GCGAGCTGGGGCAGGGGACGGCTGACTGGGTACCAAACTTCGACGGCACTTTGCAGGAGCCGAAAATGCTACCTGCCCGT
CTGCCAAACATTTTGCTTAACGGCACCACCGGTATTGCCGTCGGCATGGCGACCGATATTCCACCACATAACCTGCGTGA
AGTGGCTCAGGCGGCAATCGCATTAATCGACCAGCCGAAAACCACGCTCGATCAGCTGCTGGATATCGTGCAGGGGCCGG
ATTATCCGACTGAAGCGGAAATTATCACTTCGCGCGCCGAGATCCGTAAAATCTACGAGAACGGACGTGGTTCAGTGCGT
ATGCGCGCGGTGTGGAAGAAAGAAGATGGCGCGGTGGTTATCAGCGCATTGCCGCATCAGGTTTCAGGTGCGCGCGTACT
GGAGCAAATTGCTGCGCAAATGCGCAACAAAAAGCTGCCGATGGTTGACGATCTGCGCGATGAATCTGACCACGAGAACC
CGACCCGTCTGGTGATTGTGCCGCGTTCCAACCGCGTGGATATGGATCAGGTGATGAACCACCTCTTCGCTACCACCGAT
CTGGAAAAGAGCTATCGTATTAACCTTAATATGATCGGTCTGGATGGTCGTCCGGCGGTGAAAAACCTGCTGGAAATCCT
CTCCGAATGGCTGGTGTTCCGCCGCGATACCGTGCGCCGCCGACTGAACTATCGTCTGGAGAAAGTCCTCAAGCGCCTGC
ATATCCTCGAAGGTTTGCTGGTGGCGTTTCTCAATATCGACGAATTGATTGAGATCATTCGTAATGAAGATGAACCGAAA
CCGGCGCTGATGTCGCGGTTTGGCCTTACGGAAACCCAGGCGGAAGCGATCCTCGAACTGAAACTGCGTCATCTTGCCAA
ACTGGAAGAGATGAAGATTCGCTGTGAGCAGAGTGAGCTGGAAAAAGAGCGCGACCAGTTGCAGGGCATTTTGGCTTCCG
AGCGTAAAATGAATAACCTGCTGAAGAAAGAACTGCAGGCAGACGCGCAAGCCTACGGTGACGATCGTCGTTCGCCGTTG
CAGGAACGCGAAGAAGCGAAAGCGATGAGCGAGCACGACATGCTGCCGTCTGAACCTGTCACCATTGTGCTGTCGCAGAT
GGGCTGGGTACGCAGCGCTAAAGGCCATGATATCGACGCGCCGGGCCTGAATTATAAAGCGGGTGATAGTTTCAAAGCGG
CGGTGAAAGGTAAGAGCAACCAACCGGTAGTGTTTGTTGATTCCACCGGTCGTAGCTATGCCATCGACCCGATTACGCTG
CCGTCGGCGCGTGGTCAGGGCGAACCGCTCACCGGCAAATTAACGTTGCCGCCTGGGGCGACCGTTGACCATATACTGAT
GGAAAGCGACGATCAGAAACTGCTGATGGCTTCCGATGCGGGTTACGGTTTCGTCTGCACCTTTAACGATCTGGTGGCGC
GTAACCGTGCAGGTAAGGCTTTGATAACCTTACCGGAAAATGCCCATGTTATGCCGCCGGTGGTGATTGAAGATGCTTCC
GACATGCTGCTGGCAATCACTCAGGCAGGCCGTATGTTGATGTTCCCGGTAAGTGATCTGCCGCAGCTGTCGAAGGGCAA
AGGCAACAAGATTATCAACATTCCATCGGCAGAAGCCGCGCGTGGCGAGGATGGTCTGGCGCAACTGTACGTTCTGCCGT
CGCAAAGCACGCTGACCATTCATGTTGGGAAACGCAAAATTAAACTGCGTCCGGAAGAGCTACAGAAAGTCACTGGCGAA
CGTGGACGCCGCGGTACGTTGATGCGCGGTTTGCAGCGTATCGATCGTGTTGAGATCGACTCTCCTCGCCGTGCCAGCAG
CGGTGATAGCGAAGAGTAA

>Flq|CP001581.1|gene3048|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGGCTAAAAAAATAGTAATACCTAAAGATAACAATATAATATCTTTTCCGTTAGAAGAGGCTATGCCAGAGAATTATTT
ACCTTACGCAGTAGAAGTATCCAAGGAAAGAGCACTGCCAGATGTCAGAGATGGATTAAAACCAGTACAAAGAAGAATAG
TTTATGGTTCATATATGTTAAAAGCCTTTCCAGATAAGCCTTATTACAAATCTGCTAGAATAGTAGGTGATATATTAGGT
AAATATCACCCTCATGGAGACTCTTCTGTTTATGATGCAATGGTAATATTAGCTCAAGATTTTACCACAAGAATGCCACT
TATAGATGGACATGGAAACTGGGGAAGTCAAGATGGAGATAGTGCAGCAGCTATGCGTTATACAGAAGCAAGACTTACAC
CTATTGCCATGGAAATGATAAGAGACATAGATAAAGATGTAGTAAATATGGTAGATAACTATTCAAATTCAGAAAAAGAA
CCAGAAGTATTGCCAGCAAAGTATCCAAATATCCTTGTAAATGGTGCCTTTGGAATAGCAGTAGGGCTAGCCACTAATAT
ACCACCTCATAATTTAGTAGAAGTTATAGATGGAACTTTAGCTTACATAGATAAAAATGAAATAACTACTAAAGAGTTAT
TAAATTACATAAAGGGACCAGATCTTCCAACAGGAGGAGTTATAATAGGTAAAAAATCCATGTTATCTGCATATGAAACA
GGAGAGGGAAGAGTAACATTAAGAGCTAAGACAACCATAGAAAAATTGGAAAATGGAAGGTTATCTATTGTAATTACAGA
ATTTCCTTTTAGAAAAAACAAGGCAAAACTTCTTCAATTCATATCAGAAATGACTGCAGACAAAAAACATTCTAAAGCTT
TAGAAAATATCACGGATATAAGAGATGAATCTGATAGAAATGGAATAAGAGCAGTAATAGAATTTAAAAAAATAGCTACT
GAAGATATAGTAGAAAAAACTTTAAAATATTTATATAAAAAGACAGACCTTCAGAGTAATATATCTTTTAATATGGTAGC
ATTGGCAGATGGTAAACCTAAAACTTTAGGACTAAAGTCCATGTTAAAATACTATGTGGAGCATCAAAAAGAAGTGATTA
CCAGAAGAACAAAAAGAGAATTAGAAATAGCAGAAAAAAGATTCCATATAGTAGAAGGATTTATAAAAGCTATAGGAATA
ATGGACGAAATAATAAAAACTATAAGAGAATCAAAATCTAAAAAAAATGCTAGGGAAAATTTAATTGAAAAGTTTTCTTT
TACAGATATTCAAGCAGAGGCTATACTAGAACTTATGTTATATAAACTTACAGGCCTTGAAGTAGTAGCTTTTGAAAAGG
AATATAAAGAATTAGAAAAGTTAATAAATAAGCTTACAAAAATATTAAAAAGTGAAAAGGAACTTCTAAAAGTTATAAAG
AAAGAATTAATTGAAGTTAAAGAAACTTATAATGACAAAAGAAGAACAGCAATAATAGAAGATGATGAAAAAGCAAAAAT
AGATGTGGAAGAAATAATAGTGGAAGAAGATGTAGTATTAACTTTATCTAATGAAGGCTTTACAAAGAGAATAGCTCTTA
AATCCTATAATAGATCTAGTGCTAATGTAGAAGATATAGAGTATAGGGAAGGGGACTTTAATAGGTTTCTAATTCAGTGT
AATACAAAAGATACATTATGTTTAGTAACAAAAGAGGGAAATATGTATCAAATAAAAGTTATAAATATACCAGAATTTAA
GTGGAAAGAAAAAGGTGTTAAGCTAGATGAAATAATTAAAACTATAGATTTATCTGAAACTATAATAGAAGCCTTTTCAA
TAGAAGACTTTACGGCTCAAAAGGATATGTTATTTATAACAGATAGTGGATATATTAAGAAAACTACATTAGATAAATTT
AATACAAATTATACAAAAATAATGGCTTTAAAGCTTAAAAAAGGAGAATCCCTTGTTAAGTCTGATTTAGTAGATCGAAC
TAGAGAAGAAAAATTTTTCAATATAAAAACACAGAAGGGATTAAGCTTTAATATAGAGGAGCCTAGCTTAGAGCCAGTAG
ATAGAAATATAATAGGATACAAATTATTTGATATTTTACCTAACGATAGTATAAAAAAGGTAGACTTTTGTGATAACTAT
GAATATAAGAGTTTTTATGTAAATATATCTAAAGAGGGATTAATAACTATATCAGATTTGAAGGATAATAAATCACATAT
AAGTTTATTTACGGATTCTTCTAAAACTCTAGTTTTATTTGATGATGAGGGTAAAGCCTATTACATACCGGCATTTATGC
TTCAAAGCATAAAAGAAGAGGGTGTAAATATTTCAGCCTTTACTGGGGATAAAATAAGTTTGCTAAATGCAATATCCACC
TTTAGATTTGAAGAAGATATTAGTATCTATTTTTCATCAGAAAAAGGATTAATAAAAAGAACTTTATTGGGTGAACTAAA
GATAGAGGGTAATTCAACTCAAGTTTATAAATTTAAACATAAGGATGATAAATTAGTAAGTATACTTATAAAGGAACATG
AAGAACAAAAAAATATACTGATAATAACAGAAAAAGCAATGGTAATAAGATTTAAAAGTGAGGCTGTAAATCCTATGGGG
AAAATGGCATCAGGAGTTACAGGTATAAGTTTGAAAGATTTAGATAAAGTAATTTTAGCCTTAATAATAGATGAAAATGA
TACAAGAAAAATAAAAATAAAAACAAAGGCAAAGGATAAAGGAACTATAGAAATAAATAAAATAAAAGTTCAAAATAGAG
CAGGTATAGGAAATAGCTTGATGCCTCTTTTGTTAAATGATTTTGTAGAGGTAGTAGAATTTAAAAAATAA

>Flq|NC_010400.5984045|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGACCAGCCTTGCGCATCATGCGACAGAAAACCGCTCTGTAGCCGAATTTACTGAACAGGCTTATTTGAATTATGCCAT
GTACGTCATTATGGACCGTGCATTGCCGCATATCAGTGATGGCTTAAAGCCCGTACAGCGCCGTATTGTCTATGCTATGA
GCGAGCTAGGCTTAAAAAGCAGTGGCAAGCCAAAAAAATCAGCGCGTACAGTGGGTGATGTACTTGGTAAATACCACCCA
CATGGTGACTCGGCATGTTATGAAGCCATGGTACTCATGGCTCAGCCATTTAGTTACCGCTATCCTTTAATCGAAGGTCA
GGGGAACTGGGGCTCACCTGATGATCCTAAGTCTTTTGCTGCGATGCGTTATACCGAAGCCAAACTCTCGGCTTATAGTG
AATTATTGCTGAGCGAATTAGGTCAGGGCACTAGCGAATGGCAAGATAACTTTGATGGTTCTTTAAAAGAACCGATCACT
TTACCTGCACGTGTACCTAATATTCTTCTTAATGGTACGACGGGTATTGCTGTCGGGATGGCAACTGATATCCCGCCACA
TAATTTGCGTGAAGTTGTAAAAGGCACAATTGCTTTAATCCGTAATCCGCAAACCTCGGATGAAAAATTAGCTGAATATA
TTCCGGCTCCGGATTTACCAACCAAAGCTGAAATTATTACCCCGCCAGAAGAATTACTCAAAATCCAGACCACTGGTCGT
GGTAGTTACCGTATGCGAGCGGTATATACCATTGAGAAAAATGAAATTGTAATTACTGAGCTGCCATATCAAGTCTCTGG
TTCTAAGGTAATTACTCAAATTGCTGACCAGATGCAGGCGAAAAAGCTGCCATTAGTCGTTGATGTGCGTGATGAATCGG
ATCATGAAAACCCGACACGACTCGTGATTGTACTTCGCTCTAACCGTATTGATGCGGAAGCAGTGATGAGCCACTTATTT
GCGACCACCGATTTAGAATCAAGCTATCGTGTCAATTTAAACATGATTGGCGAAGATGGCCGTCCTCAGGTGAAATCAAT
TCGTCGTATTTTGCTTGAATGGATCGAGATCCGTAAAAAAACGGTAACTCGTCGTTTACAGTACCATTTAAACCGTATTG
AAAAGCGCCTGCATATTTTGGCAGGTCTTTTAATTGCTTATCTCGATATTGATACAGTTATTCGTATTATTCGTGAAGAA
GACCAGCCTAAGCCAGTCTTGATGGAACACTTCAATATTGATGAGATACAGGCCGAAGCGATTTTAGAGCTTAAATTACG
TCATTTGGCAAAGCTTGAAGAGATGGAAATTCGTCATGAACAAGATGAGCTTTCCGCAAAAGCTGCCATTATTCGTGAAC
AACTCGAAAATCCTGAATCTTTAAAAAACCTGATTATCAGTGAATTAAAAGAAGATGCGAAAAAGTTCGGTGATGAGCGC
CGTTCTCCAATTGTTGCACGTGCTGAAGCGGTTCAAATTAAAGAACAGGATTTAATGCCAGCTGAAACGGTAACAGTCGT
TTTGTCTGAAGCAGGCTGGGTTCGTGCGGCAAAAGGTGCGGATGTGGATGCTGAAAATCTGAACTACCGTGCTGGGGACC
AATATTTAAGTCATGCTGTCGGGAAAACCAATCAGCGAGTTTACTTCCTTGATGAAACAGGGCGCAGCTATGCCTTGCCA
ATTAGTAACTTACCTTCAGCAAGAGGCTTGGGGGATCCATTAAGTTCTAAATTATCACCAGCAAGTGGCGTATCGTTTAT
TCAGGTTTATTTAGATGATGATGAGTCTGAGTTGATTGCTGCAAGTTCGGCAGGTTATGGTTTTAAAACGCAAACCAAGC
AATTAGATACCAATGCGAAAGCCGGTAAGACATTCTTAACGGTTCCGGATAAGGCAAAGGCTTTACCACTCATTTCTGCC
CAAAACATGACGCATTTGGCTGTACTGAGCTCAGCAGGGCGTTTGTTAATTTTAGATTTGGCAGAGCTACCAAATTTAAA
TAAAGGTAAAGGTAATAAGTTGATACAACTTGAAGGAAAAGAGCAAATTTTATCCATGACAACCCTGAACTTAGATGAAA
TAATTCAGGTGGTTGCAGGTCAACAACATCTCAAATTAAAAGGTGATGATCTACAAAAATACATGGGTAAACGTGCTTCG
AAAGGTCAGCTCTTACCACGTGGATATCAAAAAGCAAATAAACTGTTGATTCAGAGATAA

>Flq|NC_002951.3237159|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
GTGAGTGAAATAATTCAAGATTTATCACTTGAAGATGTTTTAGGTGATCGCTTTGGAAGATATAGTAAATATATTATTCA
AGAGCGTGCATTGCCAGATGTTCGTGATGGTTTAAAACCAGTACAACGTCGTATTTTATATGCAATGTATTCAAGTGGTA
ATACACACGATAAAAATTTCCGTAAAAGTGCGAAAACAGTCGGTGATGTTATTGGTCAATATCATCCACATGGAGACTCC
TCAGTGTACGAAGCAATGGTCCGTTTAAGTCAAGACTGGAAGTTACGACATGTCTTAATAGAAATGCATGGTAATAATGG
TAGTATCGATAATGATCCGCCAGCGGCAATGCGTTACACTGAAGCTAAGTTAAGCTTACTAGCTGAAGAGTTATTACGTG
ATATTAATAAAGAGACAGTTTCTTTCATTCCAAACTATGATGATACGACACTCGAACCAATGGTATTGCCATCAAGATTT
CCTAACTTACTAGTGAATGGTTCTACAGGTATATCTGCAGGTTACGCGACAGATATACCACCACATAATTTAGCTGAAGT
GATTCAAGCAACACTTAAATATATTGATAATCCGGATATTACAGTCAATCAATTAATGAAATATATTAAAGGTCCTGATT
TTCCAACTGGTGGTATTATTCAAGGTATTGATGGTATTAAAAAAGCTTATGAATCAGGTAAAGGTAGAATTATAGTTCGT
TCTAAAGTTGAAGAAGAAACTTTACGCAATGGACGTAAACAGTTAATTATTACTGAAATTCCATATGAAGTGAACAAAAG
TAGCTTAGTAAAACGTATCGATGAATTACGTGCTGACAAAAAAGTCGATGGTATCGTTGAAGTACGTGATGAAACTGATA
GAACTGGTTTACGAATAGCAATTGAATTGAAAAAAGATGTGAACAGTGAATCAATCAAAAATTATCTTTATAAAAACTCT
GATTTACAGATTTCATATAATTTCAACATGGTCGCTATTAGTGATGGTCGTCCAAAATTGATGGGTATTCGTCAAATTAT
AGATAGTTATTTGAATCACCAAATTGAGGTTGTTGCAAATAGAACGAAGTTTGAATTAGATAATGCAGAAAAACGTATGC
ATATCGTTGAAGGTTTGATTAAAGCGTTGTCAATTTTAGATAAAGTAATCGAATTGATTCGTAGCTCTAAAAACAAGCGT
GACGCTAAAGAAAACCTTATCGAAGTATACGAGTTCACAGAAGAACAGGCTGAAGCAATTGTAATGTTACAGTTATATCG
TTTAACAAATACTGACATAGTTGCGCTTGAAGGTGAACATAAAGAACTTGAAGCATTAATCAAACAATTACGTCATATTC
TTGATAACCATGATGCATTATTGAATGTCATAAAAGAAGAATTGAATGAAATTAAAAAGAAATTCAAATCTGAACGACTG
TCTTTAATTGAAGCAGAAATTGAAGAAATTAAAATTGACAAAGAAGTTATGGTGCCTAGTGAAGAAGTTATTTTAAGTAT
GACACGTCATGGATATATTAAACGTACTTCTATTCGTAGCTTTAATGCTAGCGGTGTTGAAGATATTGGTTTAAAAGATG
GTGACAGTTTACTTAAACATCAAGAAGTAAATACGCAAGATACCGTACTAGTATTTACAAATAAAGGTCGTTATCTATTT
ATACCGGTTCATAAATTAGCAGATATTCGTTGGAAAGAATTGGGACAACATGTATCACAAATAGTTCCTATCGAAGAAGA
TGAAGTGGTTATTAATGTCTTTAATGAAAAGGACTTTAATACAGATGCATTTTATGTTTTTGCGACTCAAAATGGCATGA
TTAAGAAAAGTACAGTGCCTCTATTTAAAACAACGCGTTTTAATAAACCTTTAATTGCTACTAAAGTTAAAGAAAATGAT
GATTTGATTAGTGTTATGCGCTTTGAAAAAGATCAATTAATTACCGTCATTACTAATAAAGGTATGTCATTAACGTATAA
TACAAGTGAACTATCAGATACCGGATTAAGGGCAGCTGGTGTTAAATCAATAAATCTTAAAGCTGAAGATTTCGTTGTTA
TGACAGAAGGTGTTTCTGAAAATGATACTATATTGATGGCCACACAACGCGGCTCGTTAAAACGTATTAGTTTTAAAATC
TTACAAGTTGCTAAAAGAGCACAACGTGGAATAACTTTATTAAAAGAATTAAAGAAAAATCCACATCGTATTGTAGCTGC
ACATGTAGTGACAGGTGAACATAGTCAATATACATTATATTCAAAATCAAATGAAGAACATGGTTTAATTAATGATATTC
ATAAATCTGAACAATATACAAATGGCTCATTCATTGTAGATACAGATGATTTTGGTGAAGTAATAGACATGTATATTAGC
TAA

>Flq|CP000647.1|gene3437|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAGCGATATGGCAGAGCGCCTTGCGCTGCATGAATTTACGGAAAATGCTTACCTGAACTACTCCATGTACGTGATCAT
GGACAGGGCATTACCGTTTATTGGCGATGGCTTAAAACCGGTCCAGCGTCGCATCGTCTATGCGATGTCCGAGCTGGGGC
TGAACGCCAGCGCGAAATTCAAAAAGTCCGCCCGCACCGTCGGCGACGTGTTGGGTAAATATCACCCGCACGGCGACAGC
GCCTGCTATGAAGCGATGGTGCTGATGGCGCAGCCGTTCTCTTACCGCTATCCGCTGGTGGATGGTCAGGGAAACTGGGG
GGCGCCGGACGATCCCAAATCTTTCGCCGCCATGCGTTACACCGAATCCCGCCTGTCGAAGTATGCCGAGCTGCTGCTCA
GCGAGCTGGGGCAGGGGACGGTCGACTGGGTGCCAAACTTTGACGGCACGCTGCAGGAGCCGAAAATGCTGCCAGCGCGT
TTGCCGAACATCCTGCTGAACGGCACCACCGGCATCGCGGTAGGCATGGCGACCGATATTCCTCCGCACAACCTGCGGGA
AGTGGCCAAAGCGGCGATTACGCTGATTGAGCAGCCGAAAACCACCCTCGACGAACTGCTGGATATCGTACAGGGGCCGG
ATTTCCCGACCGAGGCGGAGATCATCACCTCGCGGGCGGAAATTCGCAAAATCTACCAGAACGGGCGCGGCTCAGTGCGC
ATGCGCGCGGTGTGGAGTAAAGAGGACGGCGCGGTGGTGATCAGCGCGCTGCCGCATCAGGTCTCCGGCGCCAAAGTGCT
GGAGCAGATTGCGGCGCAGATGCGCAATAAAAAGCTGCCGATGGTTGACGATCTGCGCGACGAATCGGACCACGAAAACC
CGACCCGTCTGGTAATTGTCCCGCGCTCCAACCGGGTGGATATGGAACAGGTGATGAACCACCTGTTCGCCACCACCGAT
CTGGAGAAGAGCTACCGCATCAACCTCAATATGATCGGCCTTGACGGCCGCCCGGCGGTGAAAAACCTGCTGGAGATCCT
CAGCGAGTGGCTGGTGTTCCGTCGCGATACCGTGCGTCGCCGTCTAAACCATCGGTTAGAGAAAGTGCTGAAGCGCCTGC
ATATCCTCGAAGGTTTGCTGGTGGCGTTTCTTAATATCGATGAAGTGATTGAGATCATCCGCACTGAAGATGAACCGAAG
CCGGCCCTGATGTCGCGCTTTGGCATCAGCGAAACCCAGGCGGAAGCGATTCTGGAATTAAAACTGCGCCACCTCGCCAA
ACTGGAAGAGATGAAGATCCGCGGCGAGCAGAGCGAGCTGGAAAAAGAGCGCGACCAGCTGCAGGCGATTCTGGCGTCTG
AACGTAAGATGAACAACCTGCTGAAAAAAGAGCTGCAGGCCGATGCCGATGCCTTCGGCGACGACCGTCGCTCGCCGCTT
CACGAGCGTGAAGAAGCGAAAGCGATGAGCGAACATGACATGCTGCCGTCTGAGCCGGTGACTATCGTTCTGTCGCAGAT
GGGCTGGGTGCGCAGCGCCAAAGGACACGACATTGACGCCCAGGGATTGAGCTATAAGGCGGGCGACAGCTGGAAAGCCT
CGGCGAAGGGCAAGAGCAACCAGCCGGTGGTGTTTATCGATACCACCGGACGCAGCTATGCCATCGATCCGATTACTCTG
CCTTCCGCGCGTGGCCAGGGTGAACCGCTTACCGGCAAACTGACCCTGCCGCCGGGCGCGACCGTGGAGCATATGCTAAT
GGAAAGCGACGATCAGAAACTGCTGATGGCTTCCGACGCGGGCTACGGTTTCGTCTGTACCTTCAACGATCTGGTGGCGC
GCAACCGTGCCGGGAAAGCGCTAATCACCCTGCCTGACAACGCGCACGTGATGCCGCCGCTGGTGATTGAGGATGAGTCC
GATATGCTGCTGGCCATCACCGCCGCCGGGCGGATGCTGATGTTCCCGGTCAGCGATCTGCCGCAGCTGTCGAAAGGCAA
GGGCAACAAAATTATCAGCATTCCGGCGGCGGAAGCCGCAGCCGGCCAGGACGGTCTGGCACATCTGTTTGTTCTGCCGC
CGCAGAGTACGCTGACCATTCACGTCGGCAAACGGAAGATCAAACTGCGTCCGGAAGAGCTGCAAAAAGTCACCGGCGAG
CGCGGCCGCCGCGGTTCGCTGATGCGCGGGCTGCAGAAAATTGACCGCGTGGAAATTGACTCGCCGCGTCGTGCCGCGGC
AGGCGATAGCGAAGAGTAA

>Flq|NC_010611.6237080|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGACCAGCCTTGCGCATCATGCGACAGAAAACCGCTCTGTAGCCGAATTTACTGAACAGGCTTACTTGAATTATGCTAT
GTACGTCATTATGGACCGTGCATTGCCGCATATCAGTGATGGCTTAAAGCCCGTACAGCGCCGTATTGTCTATGCTATGA
GCGAGCTAGGCTTAAAAAGCAGTGGCAAGCCAAAAAAATCAGCGCGTACAGTGGGTGATGTACTTGGTAAATACCACCCA
CATGGTGACTCGGCATGTTATGAAGCCATGGTACTCATGGCTCAGCCATTTAGTTACCGCTATCCTTTAATCGAAGGTCA
GGGGAACTGGGGTTCACCTGATGATCCTAAATCTTTTGCTGCAATGCGTTATACCGAAGCCAAGCTCTCAGCTTATAGTG
AATTATTGCTGAGCGAATTAGGTCAGGGCACTAGCGAATGGCAAGATAACTTTGATGGTTCTTTAAAAGAACCGATCACT
TTACCTGCACGTGTACCTAATATTCTTCTTAATGGTACAACAGGTATTGCTGTCGGGATGGCGACTGATATCCCGCCACA
TAATTTGCGTGAAGTTGTAAAAGGCACAATAGCTTTAATTCGTAATCCGCAAACCTCGGACGGAAAATTAGCTGAATATA
TTCCGGCTCCGGATTTACCAACCAAAGCTGAAATTATTACCCCGCCAGAAGAATTACTCAAAATCCAGACCACTGGTCGT
GGTAGTTACCGTATGCGAGCGGTATATACCATTGAGAAAAATGAAATCGTAATTACTGAGCTGCCATATCAAGTCTCTGG
TTCTAAGGTAATTACTCAAATTGCTGACCAAATGCAGGCGAAAAAGCTGCCATTAGTCGTTGATGTGCGTGATGAATCGG
ATCATGAAAACCCGACACGACTCGTGATTGTACTTCGCTCTAACCGTATTGATGCGGAAGCAGTGATGAGCCACTTATTT
GCGACCACCGATTTAGAATCAAGTTATCGTGTCAATTTAAACATGATTGGCGAAGATGGCCGTCCTCAGGTGAAATCAAT
TCGTCGTATTTTGCTTGAATGGATCGAGATCCGTAAAAAAACGGTAACTCGTCGTTTACAGTACCATTTAAACCGTATTG
AAAAGCGCCTGCATATTTTGGCAGGTCTTTTAATTGCTTATCTCGATATTGATACAGTCATTCGTATTATTCGTGAAGAA
GACCAGCCTAAGCCAGTCTTGATGGAACACTTCAATATTGATGAGATACAGGCCGAAGCGATTTTAGAGCTTAAATTACG
TCATTTGGCAAAGCTTGAAGAGATGGAAATTCGTCATGAACAAGATGAGCTTTCCGCGAAAGCTGCCATTATTCGTGAAC
AACTCGAAAATCCTGAATCTTTAAAAAATTTGATTATTGGCGAATTAAAAGAAGATGCGAAAAAGTTCGGTGATGAGCGC
CGTTCTCCAATTGTTGCACGTGCTGAAGCGGTTCAAATTAAAGAACAGGATTTAATGCCAGCTGAAACGGTAACAGTCGT
TTTGTCTGAAGCAGGCTGGGTTCGTGCGGCAAAAGGTGCGGATGTGGATGCTGAAAATCTGAACTACCGTGCTGGGGACC
AATATTTAAGTCATGCTGTCGGGAAAACCAATCAGCGAGTTTACTTCCTTGATGAAACAGGGCGCAGCTATGCCTTGCCA
ATTAGTAACTTACCTTCAGCGAGAGGCTTGGGGGATCCATTAAGTTCTAAATTATCACCAGCAAGTGGCGTATCGTTTAT
TCAGGTTTATTTAGATGATGATGAGTCTGAATTGATTGCTGCAAGTTCGGCAGGTTATGGTTTTAAAACGCAAACCAAGC
AATTAGATACCAATGCGAAAGCCGGTAAGACATTCTTAACGGTTCCGGATAAGGCAAAGGCTTTACCGCTCATTTCTGCC
CAAAACATGACGCATTTGGCTGTACTGAGCTCAGCAGGGCGTTTGTTAATTTTAGATTTGGTAGAACTACCAAATTTAAA
TAAAGGTAAAGGTAATAAGTTGATACAACTTGAAGGCAAAGAGCAAATTTTATCCATGACAACCCTGAACTTAGATGAAA
TAATTCAGGTGGTTGCAGGTCAACAACATCTCAAATTAAAAGGTGATGATCTACAAAAATACATGGGTAAACGTGCTTCG
AAAGGTCAGCTCTTACCACGTGGATATCAAAAAGCAAATAAACTGTTGATTCAGAGATAA

>CARD|pvgb|U00096|3163714-3165973|ARO:3003308|Escherichia|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
TTACTCTTCGCTATCACCGCTGCTGGCACGGCGAGGAGAGTCGATCTCAACACGATCGATACGCTGCAAACCGCGCATCA
ACGTACCGCGGCGTCCACGTTCGCCAGTGACTTTCTGTAACTCTTCCGGGCGCAGTTTAATTTTGCGTTTCCCAACATGA
ATGGTCAGCGTGCTTTGCGGCGGCAGAACGTACAATTGCGCCAGACCATCTTCTCCACGCGCGGCTTCTGCCGATGGAAT
GTTGATAATCTTGTTGCCTTTGCCCTTCGACAGCTGCGGCAGATCACTTACCGGGAACATCAACATACGGCCTGCCTGAG
TGATTGCCAGCAGCATATCGGAAGCATCTTCAATCACCACCGGCGGCATAACATGGGCATTTTCCGGTAAGGTGATCAAA
GCCTTACCTGCACGGTTACGCGCCACCAGATCGTTAAAGGTGCAGACGAAACCGTAACCCGCATCGGAAGCCATCAGCAG
TTTCTGATCGTCGCTTTCCATCAGCATATGGTCAACGGTCGCCCCAGGCGGCAACGTTAATTTGCCGGTGAGCGGCTCGC
CCTGACCACGCGCCGACGGCAGCGTAATCGGGTCAATGGCATAGCTACGACCGGTGGAATCAACAAACACTACCGGTTGG
TTGCTCTTACCTTTCACCGCCGCTTTGAAGCTATCACCCGCTTTATAATTCAGGCCCGGCGCGTCGATATCATGGCCTTT
AGCGCTGCGTACCCAGCCCATCTGCGACAGCACAATGGTGACAGGTTCAGACGGCAGCATGTCGTGCTCGCTCATCGCTT
TCGCTTCTTCGCGTTCCTGCAACGGCGAACGACGATCGTCACCGTAGGCTTGCGCGTCTGCCTGCAGTTCTTTCTTCAGC
AGGTTATTCATTTTACGCTCGGAAGCCAAAATGCCCTGCAACTGGTCGCGCTCTTTTTCCAGTTCACTCTGCTCACCGCG
AATCTTCATCTCTTCCAGTTTGGCAAGATGACGCAGTTTCAGTTCGAGGATCGCTTCCGCCTGGGTTTCCGTAAGGCCAA
ACCGCGACATCAGCGCCGGTTTCGGTTCATCTTCATTACGAATGATCTCAATCACTTCGTCGATATTGAGAAACGCCACC
AGCAAACCTTCGAGGATATGCAGGCGCTTGAGGACTTTCTCCAGACGATAGTTCAGTCGGCGGCGCACGGTATCGCGGCG
GAACACCAGCCATTCGGAGAGGATTTCCAGCAGGTTTTTCACCGCCGGACGACCATCCAGACCGATCATATTAAGGTTAA
TACGATAGCTCTTTTCCAGATCGGTGGTAGCGAAGAGGTGGTTCATCACCTGATCCATATCCACGCGGTTGGAACGCGGC
ACAATCACCAGGCGGGTCGGGTTCTCGTGGTCAGATTCATCGCGCAGATCGTCAACCATCGGCAGCTTTTTGTTGCGCAT
TTGCGCAGCAATTTGCTCCAGTACGCGCGCACCTGAAACCTGATGCGGCAATGCGCTGATAACCACCGCGCCATCTTCTT
TCTTCCACACCGCGCGCATACGCACTGAACCACGTCCGTTCTCGTAGATTTTACGGATCTCGGCGCGCGAAGTGATAATT
TCCGCTTCAGTCGGATAATCCGGCCCCTGCACGATATCCAGCAGCTGATCGAGCGTGGTTTTCGGCTGGTCGATTAATGC
GATTGCCGCCTGAGCCACTTCACGCAGGTTATGCGGTGGAATATCGGTCGCCATGCCGACGGCAATACCGGTGGTGCCGT
TAAGCAAAATGTTTGGCAGACGGGCAGGTAGCATTTTCGGCTCCTGCAAAGTGCCGTCGAAGTTTGGCACCCAGTCAGCC
GTCCCCTGCCCCAGCTCGCTCAATAGCAGCTCGGAATATTTCGACAACCGGGATTCGGTGTAACGCATTGCCGCGAACGA
TTTCGGATCGTCCGGCGCGCCCCAGTTCCCCTGACCATCAACCAGCGGATAACGGTAAGAGAACGGTTGCGCCATCAGGA
CCATCGCTTCATAACAGGCGCTATCGCCGTGCGGATGGTATTTACCCAGTACGTCACCGACGGTACGGGCCGATTTTTTA
AATTTGGCGCTGGCATTCAGGCCCAGTTCAGACATCGCATACACAATGCGGCGCTGAACAGGTTTCAGACCATCACCAAT
AAACGGCAACGCACGGTCCATGATCACGTACATGGAGTAGTTTAAGTAGGCGTTTTCCGTAAATTCATGTAGCGCAAGGC
GCTCTGCCATATCGCTCATT

>Flq|NC_007793.3913356|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
GTGAGTGAAATAATTCAAGATTTATCACTTGAAGATGTTTTAGGTGATCGCTTTGGAAGATATAGTAAATATATTATTCA
AGAGCGTGCATTGCCAGATGTTCGTGATGGTTTAAAACCAGTACAACGTCGTATTTTATATGCAATGTATTCAAGTGGTA
ATACACACGATAAAAATTTCCGTAAAAGTGCGAAAACAGTCGGTGATGTTATTGGTCAATATCATCCACATGGAGACTAC
TCAGTGTACGAAGCAATGGTCCGTTTAAGTCAAGACTGGAAGTTACGACATGTCTTAATAGAAATGCATGGTAATAATGG
TAGTATCGATAATGATCCGCCAGCGGCAATGCGTTACACTGAAGCTAAGTTAAGCTTACTAGCTGAAGAGTTATTACGTG
ATATTAATAAAGAGACAGTTTCTTTCATTCCAAACTATGATGATACGACACTCGAACCAATGGTATTGCCATCAAGATTT
CCTAACTTACTAGTGAATGGTTCTACAGGTATATCTGCAGGTTACGCGACAGATATACCACCACATAATTTAGCTGAAGT
GATTCAAGCAACACTTAAATATATTGATAATCCGGATATTACAGTCAATCAATTAATGAAATATATTAAAGGTCCTGATT
TTCCAACTGGTGGTATTATTCAAGGTATTGATGGTATTAAAAAAGCTTATGAATCAGGTAAAGGTAGAATTATAGTTCGT
TCTAAAGTTGAAGAAGAAACTTTACGCAATGGACGTAAACAGTTAATTATTACTGAAATTCCATATGAAGTGAACAAAAG
TAGCTTAGTAAAACGTATCGATGAATTACGTGCTGACAAAAAAGTCGATGGTATCGTTGAAGTACGTGATGAAACTGATA
GAACTGGTTTACGAATAGCAATTGAATTGAAAAAAGATGTGAACAGTGAATCAATCAAAAATTATCTTTATAAAAACTCT
GATTTACAGATTTCATATAATTTCAACATGGTCGCTATTAGTGATGGTCGTCCAAAATTGATGGGTATTCGTCAAATTAT
AGATAGTTATTTGAATCACCAAATTGAGGTTGTTGCAAATAGAACGAAGTTTGAATTAGATAATGCAGAAAAACGTATGC
ATATCGTTGAAGGTTTGATTAAAGCGTTGTCAATTTTAGATAAAGTAATCGAATTGATTCGTAGCTCTAAAAACAAGCGT
GACGCTAAAGAAAACCTTATCGAAGTATACGAGTTCACAGAAGAACAGGCTGAAGCAATTGTAATGTTACAGTTATATCG
TTTAACAAATACTGACATAGTTGCGCTTGAAGGTGAACATAAAGAACTTGAAGCATTAATCAAACAATTACGTCATATTC
TTGATAACCATGATGCATTATTGAATGTCATAAAAGAAGAATTGAATGAAATTAAAAAGAAATTCAAATCTGAACGACTG
TCTTTAATTGAAGCAGAAATTGAAGAAATTAAAATTGACAAAGAAGTTATGGTGCCTAGTGAAGAAGTTATTTTAAGTAT
GACACGTCATGGATATATTAAACGTACTTCTATTCGTAGCTTTAATGCTAGCGGTGTTGAAGATATTGGTTTAAAAGATG
GTGACAGTTTACTTAAACATCAAGAAGTAAATACGCAAGATACCGTACTAGTATTTACAAATAAAGGTCGTTATCTATTT
ATACCGGTTCATAAATTAGCAGATATTCGTTGGAAAGAATTGGGACAACATGTATCACAAATAGTTCCTATCGAAGAAGA
TGAAGTGGTTATTAATGTCTTTAATGAAAAGGACTTTAATACAGATGCATTTTATGTTTTTGCGACTCAAAATGGCATGA
TTAAGAAAAGTACAGTGCCTCTATTTAAAACAACGCGTTTTAATAAACCTTTAATTGCTACTAAAGTTAAAGAAAATGAT
GATTTGATTAGTGTTATGCGCTTTGAAAAAGATCAATTAATTACCGTCATTACTAATAAAGGTATGTCATTAACGTATAA
TACAAGTGAACTATCAGATACCGGATTAAGGGCAGCTGGTGTTAAATCAATAAATCTTAAAGCTGAAGATTTCGTTGTTA
TGACAGAAGGTGTTTCTGAAAATGATACTATATTGATGGCCACACAACGCGGCTCGTTAAAACGTATTAGTTTTAAAATC
TTACAAGTTGCTAAAAGAGCACAACGTGGAATAACTTTATTAAAAGAATTAAAGAAAAATCCACATCGTATTGTAGCTGC
ACATGTAGTGACAGGTGAACATAGTCAATATACATTATATTCAAAATCAAATGAAGAACATGGTTTAATTAATGATATTC
ATAAATCTGAACAATATACAAATGGCTCATTCATTGTAGATACAGATGATTTTGGTGAAGTAATAGACATGTATATTAGC
TAA

>Flq|NC_003197.1.1254697|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAGCGATATGGCAGAGCGCCTTGCGCTACATGAATTTACGGAAAACGCCTACTTAAACTACTCCATGTACGTGATCAT
GGATCGTGCGTTGCCGTTTATTGGCGACGGCCTGAAGCCGGTACAGCGCCGCATCGTCTATGCGATGTCAGAGCTGGGGC
TGAACGCCACCGCTAAATTTAAAAAATCCGCCCGTACCGTTGGTGACGTACTGGGTAAGTATCACCCGCATGGCGACAGC
GCCTGCTATGAAGCCATGGTGCTGATGGCGCAGCCGTTCTCTTACCGTTACCCGCTGGTCGATGGCCAGGGGAACTGGGG
CGCGCCGGATGATCCGAAGTCATTCGCGGCGATGCGTTATACCGAATCCCGCCTGTCCAAATACGCCGAGCTGCTGTTAA
GCGAACTCGGTCAGGGGACGGCGGACTGGGTGCCAAACTTCGACGGCACCATGCAGGAACCGAAAATGTTACCGGCGCGT
CTGCCGAACATCCTGCTGAACGGCACCACCGGTATTGCGGTGGGCATGGCAACAGATATCCCGCCGCACAACCTGCGCGA
AGTGGCGAAAGCGGCGATTACGCTGATTGAGCAGCCGAAAACGACGCTGGATCAGTTGCTGGATATCGTTCAGGGGCCGG
ATTACCCGACCGAAGCGGAGATCATTACCCCACGTGCGGAAATTCGTAAAATTTACGAAAACGGGCGGGGCTCCGTGCGT
ATGCGCGCGGTATGGACCAAAGAAGACGGCGCTGTGGTAATTTCCGCGCTGCCGCATCAGGTCTCTGGCGCGAAAGTGCT
GGAGCAGATTGCTGCGCAGATGCGTAATAAAAAACTGCCGATGGTGGACGATCTGCGCGATGAATCGGATCACGAAAACC
CGACGCGTTTAGTGATTGTGCCACGCTCCAACCGTGTGGATATGGAACAGGTGATGAACCATCTGTTCGCCACCACCGAT
CTGGAAAAAAGCTACCGTATTAACCTGAACATGATCGGTCTGGATGGTCGTCCGGCGGTGAAAAACCTGCTGGAGATCCT
CACCGAGTGGCTGGCGTTCCGCCGCGACACGGTGCGCCGTCGTCTGAACTATCGTCTGGAGAAAGTGCTTAAGCGCCTGC
ATATCCTCGAAGGTTTGCTGGTGGCGTTTCTCAACATCGACGAAGTGATTGAGATTATCCGTAGCGAAGACGAGCCAAAA
CCCGCGCTGATGTCGCGTTTCGGCATCAGCGAAACCCAGGCGGAAGCGATTCTCGAACTGAAACTGCGCCATCTCGCCAA
ACTGGAAGAGATGAAAATTCGCGGCGAGCAGGACGAGCTGGAAAAAGAGAGGGACCAGTTGCAGGGCATTCTCGCGTCCG
AACGCAAAATGAATACCTTGCTGAAAAAAGAACTACAGGCGGACGCCGATGCCTATGGCGACGATCGCCGTTCTCCGCTG
CGTGAGCGCGAAGAAGCTAAAGCGATGAGCGAACACGATATGCTGCCGTCCGAACCGGTGACTATCGTGCTGTCGCAGAT
GGGCTGGGTGCGCAGCGCCAAAGGTCATGATATTGATGCGCCGGGGCTTAACTATAAAGCGGGCGACAGCTTTAAAGCCG
CGGTGAAAGGTAAGAGCAATCAACCGGTGGTGTTTATTGATACCACCGGGCGCAGCTATGCTATTGATCCCATTACGCTT
CCGTCGGCGCGTGGGCAGGGCGAGCCGCTGACCGGCAAACTCACGCTGCCGCCGGGGGCGACCGTAGAGCATATGCTGAT
GGAAGGCGATGACCAGAAACTGCTGATGGCGTCGGATGCGGGCTACGGCTTCGTTTGTACGTTTAACGATCTGGTTGCCC
GTAACCGTGCCGGTAAGACATTGATTACACTGCCGGAAAATGCGCACGTCATGCCGCCGCTGGTGATTGAAGACGAGCAC
GATATGCTGCTGGCGATTACCCAGGCCGGACGGATGTTGATGTTCCCGGTAGACTCTCTGCCGCAGCTGTCGAAAGGCAA
AGGGAATAAGATCATTAATATCCCCTCTGCAGAAGCGGCGAAAGGCGATGATGGACTGGCGCACCTGTACGTGCTGCCGC
CACAAAGCACTCTGACTATCCATGTCGGGAAGCGCAAAATCAAACTGCGCCCTGAAGAGTTACAAAAGGTGGTCGGTGAA
CGCGGACGCCGTGGCACATTAATGCGCGGCCTGCAGCGTATCGATCGCATTGAGATTGATTCGCCGCATCGCGTAAGTCA
TGGCGACAGCGAAGAGTAA

>Flq|NC_003112.2.904301|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAATACGCAAGCGCACGCCCCACATACCGATTCCAATACGCTGATGCTCGGCCGATACGCCGAACGCGCCTATCTCGA
ATACGCCATGAGCGTGGTCAAAGGCCGCGCGCTGCCTGAAGTTTCAGACGGCCAGAAGCCCGTGCAGCGGCGCATTTTGT
TTGCCATGCGCGATATGGGTTTGACGGCGGGGGCGAAGCCGGTGAAATCGGCGCGCGTGGTCGGCGAGATTTTGGGTAAA
TACCACCCGCACGGCGACAGTTCCGCCTATGAGGCGATGGTGCGGATGGCGCAGGATTTTACCTTGCGCTATCCCTTAAT
CGACGGCATCGGCAACTTCGGCTCGCGCGACGGCGACGGGGCGGCGGCGATGCGTTACACCGAAGCGCGGCTGACGCCGA
TTGCGGAATTGCTGTTGTCCGAAATCAATCAGGGGACGGTGGATTTTGTGCCGAACTACGACGGCGCGTTTGACGAACCG
CTGCACCTGCCCGCCCGCCTGCCTATGGTGTTGCTCAACGGCGCGTCAGGCATTGCGGTGGGCATGGCGACCGAGATTCC
GCCGCACAATTTGAACGAAGTGACGCAGGCGGCGATTGCGTTGTTGAAAAAGCCGACGCTGGAAACCGCCGACCTGATGC
AATATATTCCTGCCCCCGATTTTGCCGGCGGCGGTCAAATCATCACGCCGGCGGACGAATTGCGCCGGATTTATGAAACC
GGCAAGGGCAGCGTGCGCGTGCGTGCGCGTTATGAAATCGAAAAATTGGCGCGCGGACAGTGGCGCGTCATCGTAACCGA
GCTGCCGCCGAACGCCAATTCCGCCAAAATCCTTGCCGAAATCGAAGAGCAAACCAACCCGAAACCGAAAGCGGGTAAGA
AACAGCTCAACCAAGACCAGCTCAATACCAAAAAGCTGATGCTGGATTTAATCGACCGCGTGCGCGACGAGTCCGACGGC
GAACATCCCGTGCGACTGGTATTCGAGCCGAAATCCAGCCGCATCGATACCGATACCTTCATCAACACGCTGATGGCGCA
AACTTCGCTGGAAGGCAATGTGTCGATGAACTTGGTGATGATGGGTTTGGACAACCGCCCCGCGCAGAAAAACCTGAAAA
CGATTTTGCAGGAATGGCTGGATTTCCGCACCGTAACCGTAACACGCCGTCTGAAATTCCGTTTGAACCAAGTGGAAAAA
CGGCTGCACATCCTCGAAGGCCGTCTGAAAGTCTTTCTGCACATCGACGAAGTGATTAAAGTCATCCGCGAATCAGACGA
CCCGAAAGCCGATTTGATGGCGGCGTTCGGGCTGACCGAAATCCAAGCCGAAGACATTTTGGAAATCCGCCTGCGCCAGT
TGGCGCGTTTGGAGGGTTTCAAACTCGAAAAAGAATTGAACGAGTTGCGCGAGGAACAAGGCCGTCTGAACATCCTTTTG
AGCGACGAAAACGAAAAACGCAAGCTGATTGTCAAAGAGATGCAGGCGGATATGAAACAATACGGCGACGCGCGACGCAC
GCTGGTGGAAGAGGCCGGACGCGCCGTGCTGACGCAGACCACCGCCGACGAACCCATCACGCTGATCCTGTCGGAAAAAG
GCTGGATACGCAGCCGCGCCGGACACAATCTCGATTTGAGCCAAACCGCGTTCAAAGAAGGCGACTGCCTCAAACAAACC
CTCGAAGGCAGAACGGTTTTACCCGTCGTCATCCTCGATTCATCGGGCAGAACCTACACGCTCGATGCCGCCGAAATCCC
CGGAGGGCGCGGCGACGGCGTACCGGTTTCCTCCTTAATCGAGCTGCAAAACGGCGCGAAACCCGTTGCGATGTTGACAG
GATTGCCGGAACAACATTATTTATTATCAAGCAGCAGCGGCTATGGCTTCATCACCAAGCTGGGCGATATGGTCGGGCGC
GTGAAAGCGGGCAAAGTGGTGATGACCGCAGACAGCGGCGAAACCGTTTTGCCGCCGGTTGCCGTCTATGCCTCCTCGTT
CATCAACCCCGACTGCAAAATCATTGCCGCCACCAGTCAAAACCGCGCCCTCGCCTTCCCCATCGGCGAATTGAAAATTA
TGGCGAAAGGCAAAGGGCTGCAAATCATCGGATTAAACGCCGGCGAATCGATGACGCATACCGCCGTTTCTTCCGAGCTG
GAAATCCTGATTGAAAGCGAAGGCAGGCGCGGCGCGGCGCACAAAGACCGCATCCCCATCTCCCTGCTTGAGGCAAAACG
CGGCAAAAAAGGCAGACTATTGCCCATATCGGGCAGCCTGAAACAGCTTTCTTCCCCTAAATAA

>Flq|NC_002952.2859941|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
GTGAGTGAAATAATTCAAGATTTATCACTTGAAGATGTTTTAGGTGATCGCTTTGGAAGATATAGTAAATATATTATTCA
AGAGCGTGCATTGCCAGATGTTCGTGATGGTTTAAAACCAGTACAACGTCGTATTTTATATGCAATGTATTCAAGTGGTA
ATACACACGATAAAAATTTCCGTAAAAGTGCGAAAACAGTCGGTGATGTTATTGGTCAATATCATCCACATGGAGACTTC
TCAGTGTACGAAGCAATGGTCCGTTTAAGTCAAGACTGGAAGTTACGACATGTCTTAATAGAAATGCATGGTAATAATGG
TAGTATCGATAATGATCCACCAGCGGCAATGCGTTACACTGAAGCTAAGTTAAGCTTACTAGCTGAAGAGTTATTACGTG
ATATTAATAAAGAGACAGTTTCCTTCATTTCAAACTATGATGATACGACGCTCGAACCAATGGTATTGCCATCAAGATTT
CCTAACTTACTAGTGAATGGTTCTACAGGTATATCTGCAGGTTACGCGACAGATATACCACCACATAATTTAGCTGAAGT
GATTCAAGCAACACTTAAATATATTGATAATCCGGATATTACAGTCAATCAATTAATGAAATATATTAAAGGTCCTGATT
TTCCAACTGGCGGTATTATTCAAGGTATTGATGGTATTAAAAAAGCTTATGAATCAGGTAAAGGTAGAATTATAGTTCGT
TCTAAAGTTGAAGAAGAAACTTTACGCAATGGACGTAAACAGTTAATTATTACTGAAATTCCATATGAAGTGAACAAAAG
TAGCTTAGTAAAACGTATCGATGAATTACGTGCTGACAAAAAAGTCGATGGTATCGTTGAAGTACGTGATGAAACTGATA
GAACTGGTTTACGAATAGCAATTGAATTGAAAAAAGATGTGAACAGTGAATCAATCAAAAATTATCTTTATAAAAACTCT
GATTTACAGATTTCATATAATTTCAACATGGTCGCTATTAGTGATGGTCGTCCAAAATTGATGGGTATTCGTCAAATTAT
AGATAGTTATTTAAATCATCAAATTGAGGTTGTTGCAAATAGAACGAAGTTTGAATTAGATAATGCTGAAAAACGCATGC
ATATCGTTGAAGGTTTGATTAAAGCGTTGTCAATTTTAGATAAAGTAATCGAATTGATTCGTAGCTCTAAAAACAAGCGT
GACGCTAAAGAAAACCTTATCGAAGTATACGAGTTCACAGAAGAACAGGCTGAAGCAATTGTAATGTTACAGTTATATCG
TTTAACAAACACTGACATAGTTGCGCTTGAAGGTGAACATAAAGAACTTGAAGCATTAATCAAACAATTACGTCATATTC
TTGATAACCATGATGCATTATTGAATGTCATCAAAGAAGAATTGAATGAAATTAAAAAGAAATTCAAATCTGAACGACTG
TCTTTAATTGAAGCAGAAATTGAAGAAATTAAAATTGACAAAGAAGTTATGGTGCCTAGTGAAGAAGTTATTTTAAGTAT
GACACGTCATGGATATATTAAACGTACTTCTATTCGTAGCTATAATGCTAGCGGTGTTGAAGATATTGGTTTAAAAGATG
GTGACAGTTTACTTAAACATCAAGAAGTAAATACGCAAGATACCGTACTAGTATTTACAAATAAAGGTCGTTATCTATTT
ATACCGGTTCATAAATTAGCAGATATTCGTTGGAAAGAATTGGGGCAACATGTATCACAAATAGTTCCTATCGAAGAAGA
TGAAGTGGTTATTAATGTCTTTAATGAAAAGGACTTTAATACAGATGCATTTTATGTTTTTGCGACTCAAAATGGCATGA
TTAAGAAAAGTACAGTGCCTCTATTTAAAACAACGCGTTTTAATAAACCTTTAATTGCTACTAAAGTTAAAGAAAATGAT
GATTTGATTAGTGTTATGCGCTTTGAAAAAGATCAATTAATTACCATCATTACAAATAAAGGTATGTCTTTAACTTATAA
TACAAGTGAACTATCAGATACCGGATTAAGGGCAGCTGGTGTTAAATCAATAAATCTTAAAGCAGAAGATTTCGTTGTTA
TGACAGAAGGTGTTTCTGAAAATGATACTATATTGATGGCCACACAACGCGGCTCGTTAAAACGTATTAGTTTTAAAATC
TTACAAGTTGCTAAAAGAGCACAACGTGGAATAACTTTATTAAAAGAATTAAAGAAAAATCCACATCGTATAGTAGCTGC
ACATGTAGTGACAGGTGAACATAGTCAATATACATTATATTCAAAATCAAACGAAGAACATGGTTTAATTAATGATATTC
ATAAATCTGAACAATATACAAATGGCTCATTCATTGTAGATACCGATGATTTTGGTGAAGTAATAGACATGTATATTAGC
TAA

>Flq|M58408|gene|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGTACGTGATCATGGACCGTGCGTTGCCGTTTATTGGTGATGGTCTGAAACCTGTTCAGCGCCGCATTGTGTATGCGAT
GTCTGAACTGGGCCTGAATGCCAGCGCCAAATTTAAAAAATCGGCCCGTACCGTCGGTGACGTACTGGGTAAATACCATC
CGCACGGCGATAGCGCCTGTTATGAAGCGATGGTCCTGATGGCGCAACCGTTCTCTTACCGTTATCCGCTGGTTGATGGT
CAGGGGAACTGGGGCGCGCCGGACGATCCGAAATCGTTCGCGGCAATGCGTTACACCGAATCCCGGTTGTCGAAATATTC
CGAGCTGCTATTGAGCGAGCTGGGGCAGGGGACGGCTGACTGGGTGCCAAACTTCGACGGCACTTTGCAGGAGCCGAAAA
TGCTACCTGCCCGTCTGCCAAACATTTTGCTTAACGGCACCACCGGTATTGCCGTCGGCATGGCGACCGATATTCCACCG
CATAACCTGCGTGAAGTGGCTCAGGCGGCAATCGCATTAATCGACCAGCCGAAAACCACGCTCGATCAGCTGCTGGATAT
CGTGCAGGGGCCGGATTATCCGACTGAAGCGGAAATTATCACTTCGCGCGCCGAGATCCGTAAAATCTACGAGAACGGAC
GTGGTTCAGTGCGTATGCGCGCGGTGTGGAAGAAAGAAGATGGCGCGGTGGTTATCAGCGCATTGCCGCATCAGGTTTCA
GGTGCGCGCGTACTGGAGCAAATTGCTGCGCAAATGCGCAACAAAAAGCTGCCGATGGTTGACGATCTGCGCGATGAATC
TGACCACGAGAACCCGACCCGCCTGGTGATTGTGCCGCGTTCCAACCGCGTGGATATGGATCAGGTGATGAACCACCTCT
TCGCTACCACCGATCTGGAAAAGAGCTATCGTATTAACCTTAATATGATCGGTCTGGATGGTCGTCCGGCGGTGAAAAAC
CTGCTGGAAATCCTCTCCGAATGGCTGGTGTTCCGCCGCGATACCGTGCGCCGCCGACTGAACTATCGTCTGGAGAAAGT
CCTCAAGCGCCTGCATATCCTCGAAGGTTTGCTGGTGGCGTTTCTCAATATCGACGAAGTGATTGAGATCATTCGTAATG
AAGATGAACCGAAACCGGCGCTGATGTCGCGGTTTGGCCTTACGGAAACCCAGGCGGAAGCGATCCTCGAACTGAAACTG
CGTCATCTTGCCAAACTGGAAGAGATGAAGATTCGCGGTGAGCAGAGTGAACTGGAAAAAGAGCGCGACCAGTTGCAGGG
CATTTTGGCTTCCGAGCGTAAAATGAATAACCTGCTGAAGAAAGAACTGCAGGCAGACGCGCAAGCCTACGGTGACGATC
GTCGTTCGCCGTTGCAGGAACGCGAAGAAGCGAAAGCGATGAGCGAGCACGACATGCTGCCGTCTGAACCTGTCACCATT
GTGCTGTCGCAGATGGGCTGGGTACGCAGCGCTAAAGGCCATGATATCGACGCGCCGGGCCTGAATTATAAAGCGGGTGA
TAGCTTCAAAGCGGCGGTGAAAGGTAAGAGCAACCAACCGGTAGTGTTTGTTGATTCCACCGGTCGTAGCTATGCCATTG
ACCCGATTACGCTGCCGTCGGCGCGTGGTCAGGGCGAGCCGCTCACCGGCAAATTAACGTTGCCGCCTGGGGCGACCGTT
GACCATATGCTGATGGAAAGCGACGATCAGAAACTGCTGATGGCTTCCGATGCGGGTTACGGTTTCGTCTGCACCTTTAA
CGATCTGGTGGCGCGTAACCGTGCAGGTAAGGCTTTGATCACCTTACCGGAAAATGCCCATGTTATGCCGCCGGTGGTGA
TTGAAGATGCTTCCGATATGCTGCTGGCAATCACTCAGGCAGGCCGTATGTTGATGTTCCCGGTAAGTGATCTGCCGCAG
CTGTCGAAGGGCAAAGGCAACAAGATTATCAACATTCCATCGGCAGAAGCCGCGCGTGGAGAAGATGGTCTGGCGCAATT
GTACGTTCTGCCGCCGCAAAGCACGCTGACCATTCATGTTGGGAAACGCAAAATTAAACTGCGCCCGGAAGAGTTACAGA
AAGTCACTGGCGAACGTGGACGCCGCGGTACGTTGATGCGCGGTTTGCAGCGTATCGATCGTGTTGAGATCGACTCTCCT
CGCCGTGCCAGCAGCGGTGATAGCGAAGAGTAA

>Flq|NC_012469.1.7685406|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
TTGTATCTTATGTCTAACATTCAAAACATGTCCCTGGAGGACATCATGGGAGAGCGCTTTGGTCGCTACTCCAAGTACAT
TATTCAAGACCGGGCTTTGCCAGATATTCGTGATGGGTTGAAGCCGGTTCAGCGCCGTATTCTTTATTCTATGAATAAGG
ATAGCAATACTTTTGACAAGAGCTACCGTAAGTCGGCCAAGTCAGTCGGGAACATCATGGGGAATTTCCACCCACACGGG
GATTCTTCTATCTATGATGCCATGGTTCGTATGTCACAGAACTGGAAAAATCGTGAGATTCTAGTTGAAATGCACGGTAA
TAACGGTTCTATGGACGGAGATCCTCCTGCGGCTATGCGTTATACTGAGGCACGTTTGTCTGAAATTGCAGGCTACCTTC
TTCAGGATATCGAGAAAAAGACAGTTCCTTTTGCATGGAACTTTGACGATACGGAGAAAGAACCAACGGTCTTGCCAGCA
GCCTTTCCAAACCTCTTGGTCAATGGTTCGACTGGGATTTCGGCTGGTTATGCCACAGACATTCCTCCCCATAATTTAGC
TGAGGTCATAGATGCTGCAGTTTACATGATTGACCACCCAACTGCAAAGATTGATAAACTCATGGAATTCTTGCCTGGAC
CAGACTTCCCTACAGGGGCTATTATTCAGGGTCGTGATGAAATCAAGAAAGCTTATGAGACTGGGAAAGGGCGCGTGGTT
GTTCGTTCCAAGACTGAAATTGAAAAGCTAAAAGGTGGTAAGGAACAAATCGTTATTACTGAGATTCCTTATGAAATCAA
TAAGGCCAATCTAGTCAAGAAAATCGATGATGTTCGTGTTAATAACAAGGTAGCTGGGATTGCTGAGGTTCGTGATGAGT
CTGACCGTGATGGTCTTCGTATCGCTATCGAACTTAAGAAAGACGCTAATACTGAGCTTGTTCTCAACTACTTATTTAAG
TACACCGACCTACAAATCAACTACAACTTTAATATGGTGGCGATTGACAATTTCACACCTCGTCAGGTTGGGATTGTTCC
AATCCTGTCTAGCTACATCGCTCACCGTCGAGAAGTGATTTTGGCGCGTTCACGCTTTGACAAAGAAAAGGCTGAGAAAC
GTCTCCATATCGTCGAAGGTTTGATTCGTGTGATTTCGATTTTGGATGAAGTCATTGCTCTTATCCGTGCTTCTGAGAAT
AAGGCGGACGCCAAGGAAAACCTCAAAGTTAGCTATGATTTTACGGAAGAACAGGCTGAGGCTATCGTAACTTTGCAACT
GTACCGTTTGACCAATACCGATGTGGTTGTCTTGCAGGAAGAAGAAGCAGAGCTTCGTGAGAAGATTGCTATGCTGGCGG
CTATTATCGGTGATGAAAGGACTATGTACAATCTCATGAAGAAAGAACTTCGTGAGGTCAAGAAGAAATTTGCAACTCCT
CGTTTGAGTTCTTTAGAAGACACTGCGAAAGCAATTGAGATTGATACAGCTAGTCTTATCGCTGAGGAAGATACCTACGT
CAGCGTGACCAAGGCAGGTTACATCAAGCGTACCAGTCCACGTTCCTTTGCGGCTTCCACCTTGGAAGAAATTGGCAAGC
GTGATGATGACCGTTTGATTTTTGTTCAATCTGCCAAGACAACCCAGCACCTCTTGATGTTCACAAGTCTTGGAAATGTC
ATCTACAGACCAATCCATGAGTTGGCAGATATTCGTTGGAAGGACATCGGAGAGCATCTGAGCCAAACCATCACAAACTT
TGAAACGAATGAAGAAATCCTTTATGTGGAAGTACTGGATCAGTTTGACGATGCGACAACCTACTTTGCAGTGACTCGCC
TTGGTCAAATCAAACGGGTAGAGCGAAAAGAATTCACTCCATGGCGGACCTATAGATCTAAGTCTGTCAAGTATGCTAAG
CTCAAAGACGATACAGATCAGATTGTAGCAGTGGCTCCGATTAAACTAGATGATGTTGTCTTGGTTAGTCAAAATGGTTA
TGCCCTGCGTTTCAATATCGAAGAGGTTCCGGTTGTCGGTGCTAAGGCAGCAGGTGTCAAGGCTATGAATTTGAAAGAAG
ATGATGTCCTCCAATCTGGCTTTATCTGTAATACTTCGTCCTTCTACCTCTTGACCCAGCGTGGAAGCTTGAAACGTGTT
TCCATTGAGGAAATTCTAGCAACCAGCCGTGCCAAACGAGGATTACAAGTCTTGCGTGAGTTGAAAAACAAACCGCATCG
TGTCTTCTTGGCAGGAGCAGTTGCAGAGCAAGGATTTGTTGGCGATTTCTTCAGTACGGAAGTGGATGTGAACGACCAAA
CTCTGCTTGTCCAATCCAATAAAGGAACAATCTATGAAAGCCGATTGCAAGACTTGAACTTGTCAGAACGCACTAGCAAT
GGAAGCTTCATTTCTGACACGATTTCAGATGAAGAAGTTTTTGACGCTTATCTTCAGGAAGTAGTTACTGAAGATAAATA
A

>Flq|NC_007622.3794231|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
GTGAGTGAAATAATTCAAGATTTATCACTTGAAGATGTTTTAGGTGATCGCTTTGGAAGATATAGTAAATATATTATTCA
AGAGCGTGCATTGCCAGATGTTCGTGATGGTTTAAAACCCGTACAACGTCGTATTTTATATGCAATGTATTCAAGTGGTA
ATACACACGATAAAAATTTCCGTAAAAGTGCGAAAACAGTCGGTGATGTTATTGGTCAATATCATCCACATGGAGACTCC
TCAGTGTACGAAGCAATGGTCCGTTTAAGTCAAGACTGGAAGTTACGACATGTCTTAATAGAAATGCATGGTAATAATGG
TAGTATCGATAATGATCCGCCAGCGGCAATGCGTTACACTGAAGCTAAGTTAAGCTTACTAGCTGAAGAGTTATTACGTG
ATATTAATAAAGAGACAGTTTCTTTCATTCCAAACTATGATGATACGACACTCGAACCAATGGTATTGCCATCAAGATTT
CCTAACTTACTAGTGAATGGTTCTACAGGTATATCTGCAGGTTACGCGACAGATATACCACCACATAATTTAGCTGAAGT
GATTCAAGCAACACTTAAATATATTGATAATCCAGATATTACAGTCAATCAATTAATGAAATATATTAAAGGTCCTGATT
TTCCAACTGGTGGTATTATTCAAGGTATTGATGGTATTAAAAAAGCTTATGAATCAGGTAAAGGTAGAATTATAGTTCGT
TCTAAAGTTGAAGAAGAAACTTTACGCAATGGACGTAAACAGTTAATTATTACTGAAATTCCATATGAAGTGAACAAAAG
TAGCTTAGTAAAACGTATCGATGAATTACGTGCTGACAAAAAAGTCGATGGTATCGTTGAAGTACGTGATGAAACTGATA
GAACTGGTTTACGAATAGCAATTGAATTGAAAAAAGATGTGAACAGTGAATCAATCAAAAATTATCTTTATAAAAACTCT
GATTTACAGATTTCATATAATTTCAACATGGTCGCTATTAGTGATGGTCGTCCAAAATTGATGGGTATTCGTCAAATTAT
AGATAGTTATTTGAATCATCAAATTGAGGTTGTTGCAAATAGAACGAAGTTTGAATTAGATAATGCTGAAAAACATATGC
ATATCGTCGAAGGTTTGATTAAAGCGTTGTCAATTTTAGATAAAGTAATCGAATTGATTCGTAGCTCTAAAAACAAGCGT
GACGCTAAAGAAAACCTTATCGAAGTATACGAGTTCACAGAAGAACAGGCTGAAGCAATTGTAATGTTACAGTTATATCG
TTTAACAAACACTGACATAGTTGCGCTTGAAGGTGAACATAAAGAACTTGAAGCATTAATCAAACAATTACGTCATATTC
TTGATAACCATGATGCATTATTGAATGTCATAAAAGAAGAATTGAATGAAATTAAAAAGAAATTCAAATCTGAACGACTG
TCTTTAATTGAAGCAGAAATTGAAGAAATTAAAATTGACAAAGAAGTTATGGTGCCTAGTGAAGAAGTTATTTTAAGTAT
GACACGTCATGGATATATTAAACGTACTTCTATTCGTAGCTTTAATGCTAGCGGTGTTGAAGATATTGGTTTAAAAGATG
GTGATAGTTTACTTAAACATCAAGAAGTAAATACGCAAGATACCGTACTAGTATTTACAAATAAAGGTCGTTATCTATTT
ATACCGGTTCATAAATTAGCAGATATTCGTTGGAAAGAATTGGGGCAACATGTATCACAAATAGTTCCTATCGAAGAAGA
TGAAGTGGTTATTAATGTCTTTAATGAAAAGGACTTTAATACAGATGCATTTTATGTTTTTGCGACTCAAAATGGCATGA
TTAAGAAAAGTACAGTGCCTCTATTTAAAACAACGCGTTTTAATAAACCTTTAATTGCTACTAAAGTTAAAGAAAATGAT
AATTTGATTAGTGTTATGCGCTTTGAAAAAGATCAATTAATTACCATCATTACTAATAAAGGTATGTCATTAACGTATAA
TACAAGTGAACTATCAGATACCGGATTAAGGGCAGCTGGTGTTAAATCAATAAATCTTAAAGCTGAAGATTTCGTTGTTA
TGACTGAAGGTGTTTCTGAAAATGATACTATATTGATGGCCACACAACGCGGCTCGTTAAAACGTATTAGTTTTAAAATC
TTACAAGTTGCTAAAAGAGCACAACGTGGAATAACTTTATTAAAAGAATTAAAGAAAAATCCACATCGTATAGTAGCTGC
ACATGTAGTGACAGGTGAACATAGTCAATATACATTATATTCAAAATCAAACGAAGAACATGGTTTAATTAATGATATTC
ATAAATCTGAGCAATATACAAATGGCTCATTCATTGTAGATACAGATGATTTTGGTGAAGTAATAGACATGTATATTAGC
TAA

>Flq|NC_003098.1.934295|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
TTGTATCTTATGTCTAACATTCAAAACATGTCCCTGGAGGACATCATGGGAGAGCGCTTTGGTCGCTACTCCAAGTACAT
TATTCAAGACCGGGCTTTGCCAGATATTCGTGATGGGTTGAAGCCGGTTCAACGCCGTATTCTTTATTCTATGAATAAGG
ATAGCAATACTTTTGACAAGAGCTACCGTAAGTCGGCCAAGTCAGTCGGGAACATCATGGGGAATTTCCACCCACACGGG
GATTCTTCTATCTATGATGCCATGGTTCGTATGTCACAGAACTGGAAAAATCGTGAGATTCTAGTTGAAATGCACGGTAA
TAACGGTTCTATGGACGGAGATCCTCCTGCGGCTATGCGTTATACTGAGGCACGTTTGTCTGAAATTGCAGGCTACCTTC
TTCAGGATATCGAGAAAAAGACAGTTCCTTTTGCATGGAACTTTGACGATACGGAGAAAGAACCAACGGTCTTGCCAGCA
GCCTTTCCAAACCTCTTGGTCAATGGTTCGACTGGGATTTCGGCTGGTTATGCCACAGACATTCCTCCCCATAATTTAGC
TGAGGTCATAGATGCTGCAGTTTACATGATTGACCACCCAACTGCAAAGATTGATAAACTCATGGAATTCTTACCTGGAC
CAGACTTCCCTACAGGGGCTATTATTCAGGGTCGTGATGAAATCAAGAAAGCCTATGAGACTGGGAAAGGGCGCGTGGTT
GTTCGTTCCAAGACTGAAATTGAAAAGCTAAAAGGTGGTAAGGAACAAATCGTTATTACTGAGATTCCTTATGAAATCAA
TAAGGCCAATCTAGTCAAGAAAATCGATGATGTTCGTGTTAATAACAAGGTAGCTGGGATTGCTGAGGTTCGTGATGAGT
CTGACCGTGATGGTCTTCGTATCGCTATTGAACTTAAGAAAGACGCTAATACTGAGCTTGTTCTCAACTACTTATTTAAG
TACACCGACCTACAAATCAACTACAACTTTAATATGGTGGCGATTGACAATTTCACACCTCGTCAGGTTGGGATTGTTCC
AATCCTGTCTAGCTACATCGCTCACCGTCGAGAAGTGATTTTGGCGCGTTCACGCTTTGACAAAGAAAAGGCTGAGAAAC
GTCTCCGTATCGTCGAAGGTTTGATTCGTGTGATTTCGATTTTGGATGAAGTCATTGCTCTTATCCGTGCTTCTGAGAAT
AAGGCGGACGCCAAGGAAAACCTCAAAGTTAGCTATGATTTTACGGAAGAACAGGCTGAGGCTATCGTAACTTTGCAACT
GTACCGTTTGACCAATACCGATGTGGTTGTCTTGCAGGAAGAAGAAGCAGAGCTTCGTGAGAAGATTGCTATGCTGGCGG
CTATTATCGGTGATGAAAGGACTATGTACAATCTCATGAAGAAAGAACTTCGTGAGGTCAAGAAGAACTTTGCAACTCCT
CGTTTGAGTTCTTTAGAAGACACTGCGAAAGCAATTGAGATTGATACAGCTAGTCTTATCGCTGAGGAAGATACCTACGT
CAGCGTGACCAAGGCAGGTTACATCAAGCGTACCAGTCCACGTTCCTTTGCGGCTTCCACCTTGGAAGAAATTGGCAAGC
GTGATGATGACCGTTTGATTTTTGTTCAATCTGCCAAGACAACCCAGCACCTCTTGATGTTCACAAGTCTTGGAAATGTC
ATCTACAGACCAATCCATGAGTTGGCAGATATTCGTTGGAAGGACATCGGAGAGCATCTGAGCCAAACCATCACAAACTT
TGAAACGAATGAAGCAATCCTTTATGTGGAAGTACTGGATCAGTTTGACGATGCGACAACCTACTTTGCAGCGACTCGCC
TTGGTCAAATCAAACGGGTAGAGCGAAAAGAATTCACTCCATGGCGGACCTATAGATCTAAGTCTGTCAAGTATGCTAAG
CTCAAAGACGATACAGATCAGATTGTAGCAGTGGCTCCGATTAAACTAGATGATGTTGTCTTGGTTAGTCAAAATGGTTA
TGCCCTGCGTTTCAATATCGAAGAGGTTCCGGTTGTCGGTGCTAAGGCAGCAGGTGTCAAGGCTATGAATTTGAAAGAAG
ATGATGTCCTCCAATCTGGCTTTATCTGTAATACTTCGTCCTTCTACCTCTTGACCCAGCGTGGAAGCTTGAAACGTGTT
TCCATTGAGGAAATTCTAGCAACCAGCCGTGCCAAACGAGGATTACAAGTCTTGCGTGAGTTGAAAAACAAACCGCATCG
TGTCTTCTTGGCAGGAGCAGTTGCAGAGCAAGGATTTGTTGGCGATTTCTTCAGTACGGAAGTGGATGTGAACGACCAAA
CTCTGCTTGTCCAATCCAATAAAGGAACAATCTATGAAAGCCGATTGCAAGACTTGAACTTGTCAGAACGCACTAGCAAT
GGAAGCTTCATTTCTGACACGATTTCAGATGAAGAAGTTTTTGACGCTTATCTTCAGGAAGTAGTTACTGAAGATAAATA
A

>Flq|NC_002745.1124026|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
GTGAGTGAAATAATTCAAGATTTATCACTTGAAGATGTTTTAGGTGATCGCTTTGGAAGATATAGTAAATATATTATTCA
AGAGCGTGCATTGCCAGATGTTCGTGATGGTTTAAAACCAGTACAACGTCGTATTTTATATGCAATGTATTCAAGTGGTA
ATACACACGATAAAAATTTCCGTAAAAGTGCGAAAACAGTCGGTGATGTTATTGGTCAATATCATCCACATGGAGACTCC
TCAGTGTACGAAGCAATGGTCCGTTTAAGTCAAGACTGGAAGTTACGACATGTCTTAATAGAAATGCATGGTAATAATGG
TAGTATCGATAATGATCCGCCAGCGGCAATGCGTTACACTGAAGCTAAGTTAAGCTTACTAGCTGAAGAGTTATTACGTG
ATATTAATAAAGAGACAGTTTCTTTCATTCCAAACTATGATGATACGACACTCGAACCAATGGTATTGCCATCAAGATTT
CCTAACTTACTAGTGAATGGTTCTACAGGTATATCTGCAGGTTACGCGACAGATATACCACCACATAATTTAGCTGAAGT
GATTCAAGCAACACTTAAATATATTGATAATCCGGATATTACAGTCAATCAATTAATGAAATATATTAAAGGTCCTGATT
TTCCAACTGGTGGTATTATTCAAGGTATTGATGGTATTAAAAAAGCTTATGAATCAGGTAAAGGTAGAATTATAGTTCGT
TCTAAAGTTGAAGAAGAAACTTTACGCAATGGACGTAAACAGTTAATTATTACTGAAATTCCATATGAAGTGAACAAAAG
TAGCTTAGTAAAACGTATCGATGAATTACGTGCTGACAAAAAAGTCGATGGTATCGTTGAAGTACGTGATGAAACTGATA
GAACTGGTTTACGAATAGCAATTGAATTGAAAAAAGATGTGAACAGTGAATCAATCAAAAATTATCTTTATAAAAACTCT
GATTTACAGATTTCATATAATTTCAACATGGTCGCTATTAGTGATGGTCGTCCAAAATTGATGGGTATTCGTCAAATTAT
AGATAGTTATTTGAATCATCAAATTGAGGTTGTTGCAAATAGAACGAAGTTTGAATTAGATAATGCTGAAAAACGTATGC
ATATCGTTGAAGGTTTGATTAAAGCGTTGTCAATTTTAGATAAAGTAATTGAATTGATTCGTAGCTCTAAAAACAAGCGT
GACGCTAAAGAAAACCTTATCGAAGTATTCGAGTTCACAGAAGAACAGGCTGAAGCAATTGTAATGTTACAGTTATATCG
TTTAACAAACACTGACATAGTTGCGCTTGAAGGTGAACATAAAGAACTTGAAGCATTAATCAAACAATTACGTCATATTC
TTGATAACCATGATGCATTATTGAATGTCATAAAAGAAGAATTGAATGAAATTAAAAAGAAATTCAAATCTGAACGACTG
TCTTTAATTGAAGCAGAAATTGAAGAAATTAAAATTGACAAAGAAGTTATGGTGCCTAGTGAAGAAGTTATTTTAAGTAT
GACACGTCATGGATATATTAAACGTACTTCTATTCGTAGCTTTAATGCTAGCGGTGTTGAGGATATTGGTTTAAAAGATG
GTGACAGTTTACTTAAACATCAAGAAGTAAATACGCAAGATACCGTACTAGTATTTACAAATAAAGGTCGTTATCTATTT
ATACCGGTTCATAAATTAGCAGATATTCGTTGGAAAGAATTGGGGCAACATGTATCACAAATAGTTCCTATCGAAGAAGA
TGAAGTGGTTATTAATGTCTTTAATGAAAAGGACTTTAATACAGATGCATTTTATGTTTTTGCGACTCAAAATGGCATGA
TTAAGAAAAGTACAGTGCCTCTATTTAAAACAACGCGTTTTAATAAACCTTTAATTGCTACTAAAGTTAAAGAAAATGAT
GATTTGATTAGTGTTATGCGCTTTGAAAAAGATCAATTAATTACCGTCATTACTAATAAAGGTATGTCATTAACGTATAA
TACAAGTGAACTATCAGATACCGGATTAAGGGCAGCTGGTGTTAAATCAATAAATCTTAAAGCTGAAGATTTCGTTGTTA
TGACAGAAGGTGTTTCTGAAAATGATACTATATTGATGGCCACACAACGCGGCTCGTTAAAACGTATTAGTTTTAAAATC
TTACAAGTTGCTAAAAGAGCACAACGTGGAATAACTTTATTAAAAGAATTAAAGAAAAATCCACATCGTATTGTAGCTGC
ACATGTAGTGACAGGTGAACATAGTCAATATACATTATATTCAAAATCAAATGAAGAACATGGTTTAATTAATGATATTC
ATAAATCTGAACAATATACAAATGGCTCATTCATTGTAGATACAGATGATTTTGGTGAAGTAATAGACATGTATATTAGC
TAA

>Flq|CR628337.1|gene3018|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAAGAAAATACCCAATATGAATGAAGTAACTGAAAAAAAGCCGCTTACTGAGTTTACAGAAAAAGCTTATCTTGATTA
TTCAATGTATGTCATTTTGGACAGAGCATTACCGAGCATCGCAGATGGACTTAAGCCTGTCCAACGCAGAATTGTTTATG
CTATGTCTGAGTTGGGTTTGAAAGCAACAGCAAAATATAAAAAATCAGCGCGTACAGTAGGGGATGTTCTTGGTAAATTC
CATCCTCATGGTGATAGTGCATGCTATGAAGCTATGGTATTAATGGCACAACCTTTCTCGTATCGTTATCCTTTTGTTGA
TGGACAAGGAAATTGGGGATCCCCGGATGATCCCAAATCATTTGCTGCAATGAGATATACAGAAGCAAGATTATCTCATT
ATGCTGATGTGTTACTTGGAGAACTGCTACAAGGAACCGTAGATTGGGTAGATAATTTTGATGGTACTTTGCAAGAGCCA
GCTCTTTTACCAGCACGTTTGCCTAATATTTTATTGAATGGTGCAACAGGTATAGCTGTTGGTATGGCTTCAGATATTCT
TCCGCACAATTTGACTGAAGTTGCTAATGCGTGTATTCATCTGCTGGATAACCCCCAAGCCGATATTAAGACTATATGTG
AATATATTAAAGGCCCTGATTTTCCAACAGAAGCAGAAATCATTAGCCCAAGTGAAACAATTAGAGCTATGTACGAGTCT
GGTAATGGCTCAATTAAAATGCGAGCAATTTATACTCAAGAAAAACAAAATATCGTCATAACCGCTTTGCCTTATCAAGT
ATCCGGAGCTAGGGTAATGGAGCAAATTGCGTTGCAGATGCAACAGAAAAAATTACCGATGGTTGAGGATTTACGTGATG
AATCAGATCACGAGCATCCAACACGGTTGGTTATTATCCCTCGTTCTAATCGAGTAGATATAGAAAGTTTAATGTCGCAT
TTATTTGCTACCACGGATTTGGAGCGTAGCTATCGAGTTAATTTTAATATGATTGGGCTTGATGGCAAGCCAAGGGTTAA
AGGACTGTTAGCAATCTTGACTGAATGGTTGGAATTTAGGCTTGCCACAGTAAAAAGACGTCTTCAATTCAGATTGGAAA
AGGTACTGGAGCGTATTCATATTCTTGAAGGATTGCTTATCGCCTATCTTAATATAGATGAAGTCATTGCAATCATCAGA
GAACATGAGCAACCAAAACAAGGATTAATTTCGCGCTTTAACTTAACCGAAAGACAGGCTGAAGCAATTTTGGAAATGAA
ACTGCGGCATTTAGCCAAATTGGAAGAGATTAAATTGCGTGGTGAACTGGACGAGCTGTCTGATGAACGTGATACTTTAC
AAAAAACGCTGGCTAGTCATTTTCTCTTAAAAGAACTGGTAAAAGAAGAGATAACGAAAGATCGAGATGAGTTTGGTGAC
CCACGCCGTTCACCCATTATTACAAGGGAGGACTCTCAGGCATTAAAAGAAGAGGATATTTTGCCTAATGAGCCTATTAC
GGTTGTATTGTCTAAAAATGGATGGGTCAGAGCGGCCAAGGGGCATGATGTCGATGGTAAGGAACTCAGCTATAAAGCTG
GAGATGAATTCAAAGCCCAAACGCTAGCTCGTACTAATCAGCAAGTTTTATTTTTTGATGGAGAGGGAAAGGTCTATTCG
CTTCCAGGACATGTATTGCCATCAGCACGTGGTCAAGGCGAGCCTTTGACCGGAAAATTAAACCCTGCTGAAGGAGTATT
GTTTGAAGCAATTGTTGGCGGAGAGCCTGAGCAAAAGGTGTTATTGGCTACTGATTCCGGGTATGGATTTATCGCCAAAA
TTGAAGATTTATATGTAAAAAATCGTAATGGAAAGGCATGCATCAAATTAAGTGAAAAAAGTCATATATTGCCGCCAAGG
CTAATACCAAATCGAGAGCAATTATTTGTTGCTTGTGCAACGAATGTAGGGCGTTTATTGATTTTTTCTCTTGAGGAGTT
GCCCGAATTATCTCGAGGAAAAGGGAATAAATTGATCAGTATCCCTGCCGCTAAAGCGGTCTCACGAGAAGAGTATATAG
TTGATATACAAGTTTTAACAACAAATGATTCACTGACAGTTCATGCCGGTAAGCGGCATTTTACTCTGAAAGGTGAGGAT
TTGACTCACTATAAGGGTGAACGGGGCAGGAGAGGAAACCGGTTGCCAAGAGGTTTACAAAATGTTTCTCAATTACATGT
TACTCAATCTGAGTAA

>Flq|CP003583.1|gene1174|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGGAAAATCGACAAGAAGTACAAGAATTAACTTTAGAAGAAGTGATGGGTGACCGCTTCGGACGTTATTCCAAATATAT
TATCCAAGAACGTGCACTGCCTGATATCCGTGATGGATTGAAGCCAGTGCAACGCCGGATATTATTTGCCATGAACAAAG
ATGGCAATACGTATGACAAAGGATTCCGTAAATCAGCAAAATCTGTCGGAAATATCATGGGGAATTATCATCCTCATGGT
GACAGCAGTATTTATGAAGCGATGGTCCGCATGAGCCAAGACTGGAAGTTGCGGGAAGTACTGATCGAAATGCACGGGAA
TAACGGGAGTATGGACGGTGATCCACCTGCTGCGATGCGTTATACTGAAGCCAGATTATCCAAGTTAAGTGGAGAGATGC
TAGCAGATATCGAGAAAGAAACAGTCGATCTCGTGTGGAATTTTGATGATACAGAAAAAGAACCAACAGTCCTTCCAGCT
CGATACCCAAACCTTCTCGTCAATGGATCGACAGGTATATCTGCTGGATATGCAACAGAAATCCCGACTCATAACTTAGC
TGAAGTGATCGATGGCACAATCTATATGATCGATCATCCACAAGCGAGCCTTGAAAAATTGATGGAATATATTCCTGGAC
CTGACTTTCCAACAGGAGGGATCTTGCAAGGAAAAGATGAAATCAAAAAAGCTTATGAAACAGGACGAGGAAAAGTTATT
CTTCGTTCGAAAACAAAGATAGAGGCAATGAAGGGTAATAAACAGCAAATCGTGATCACAGAAATCCCATATGAAGTAAA
TAAAGCGACCTTGGTGAAAAAAATGGATGAGATCCGTTTGAATAAGAAAATCGATGGAATAGCTGAAGTACGAGATGAAA
GTGATAGAACAGGTCTGCAAATTGTCGTCGAATTGAAAAAAGACGCCAATGCTCAAGGAATTTTGAATTATTTGTTCAAA
AACACTGAGCTACAGATCAATTACAATTTCAATATGGTCGCTATCGACCATATGACTCCGCATCAAGTTGGACTGAAAGA
CATTTTAAGAAGTTATATCGAGCATCGAAAGCAAGTCATAACAAAACGTAGTCAATTCGATTTAGCCAAAGCTCAAAAAA
GACAGCATATCGTAGAAGGATTGATGAAAGCTTTATCGATTCTGGATGAAGTAATCGCAACGATTCGTGAAAGTAAAGAC
AAAAAAGACGCCAAAAAGAATTTAGTCGACGTCTTTCAATTTACAGAAGAACAAGCAGAAGCAATTGTCACATTGCAATT
ATACCGTTTGACGAACACGGATATCACAGAGCTTCAAAAGGAATCCGAAAGCTTGATTGCGCAAATCACAGAGTTGAATA
AAATCCTTTCAAATGACAAAGAGCTTTTCTCTGTTATGAAAAAAGAATTGCGAGAAGTGAAAAAAAATTATTCTTCCGCT
CGTCTAACGACAATCGAAGACGAAATCGAAGAAATCAAAATTGATACGCAAGTCTTAGTGGCACAAGAAGACGTAATTGT
CAGTGTGACGCGAGAAGGCTATGTGAAGCGAACAAGCCTTCGTTCTTATAGTGCTTCCAAACCAGAAGAAATCGGGATGC
GAGAAGGCGACTACTTGCTATACTCAGGTGAATTGAGTACATTGGACCATGTTCTTCTGATCACAAATAAAGCAAATGTG
ATCTACCGCCCTGTCCATGAACTACCCGATTTGAAATGGAAAGATGCTGGTGAGCACATTTCTCAAACAATCTCCAATCT
GTCTGTAGACGAATCGATTTTAGCTGTTTTCCCATATCAAAAAATTCAAGCAGAGAAAACATTTGTATTCATCAGCAAGA
ATGGATTGATCAAGCAAACACGAATGACAGAGTTCGAACCATGGCGCACCTATAAGAGCCGTCCGCTCAGCTGTATGAAG
CTAAAGGCGGAAGAAGATGAACTGATTGCTGTGTATCTGAAAGAAGATCAGCCAGGCTTAGATGTTTTCTTAGTAACGCA
TCAAGGAATGGGTTTGCGCTATCCTTTAACAGATGTTCCCGTTGTTGGAGCAAAGGCAGCTGGAGTGAAGTCTATGAATT
TGAAAGATGGAGATAGGATTATCAACGGGCTGCTTGTGTTAGCAGAAGGTGATACGCCGATCGTAATCGTTACTCAGCGA
GGAGCTGTTAAACGCATGCTTGCTCAAGAAATCAGCCAAACTTCACGTGCGAAGCGGGGAGTGACGGTCATGCGTGAGCT
GAAAAAAAATCCGCACCGTATTATCTATATGTCGGAAGGAAGATCAAAAGAAATAACCTTGATGAATCAAAAAGGGCAGC
AGTTAACGATTGACCCAACTGATTTCCCTATAGGTGATCGAACATCGAATGGATCATTTGCGATGGATGAGAAAAAAGGT
GGAGAAGTCATCGAAGTTATCGATGCTCCTGAGATTTTCATCGAGTCGTAA

>Flq|NC_006582.1.3202074|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
GTGGCAAAATCAGAACGTTATCTCGACCTTCCTTTAGAAGAAGTCATCGGCGACCGTTTTAGCCGCTACAGCAAATACAT
TATCCAGGAACGGGCATTGCCTGATGCCAGAGACGGACTAAAGCCTGTGCAACGCCGTATTTTGTATGCAATGTACAATG
AAGGCAATACGGCCGATAAACCGTATCGAAAGGCAGCCAAAACGGTTGGAAACGTCATCGGCAATTACCATCCCCATGGC
GACAGTTCCGTGTATGAAGCAATGGTCCGCATGAGCCAAGAATGGAAAGTGCGTGAACAATTAATCGACATGCACGGCAA
CAACGGTTCAGTGGATGGCGATCCACCGGCGGCCATGCGTTATACGGAAGCGCGGCTATCGGCGATTAGTGCAGAGTTGA
TGCGTGATTTAGATAAAGGCACAGTCGACTACATCCCGAACTTTGATGATTCAATTGAAGAGCCCGTCGTCTTGCCGGCG
ATGTTTCCAAATTTGCTTGTGAATGGTTCAACAGGTATTTCGGCTGGTTACGCGACAGACATACCGCCTCATCACTTGCC
AGAGATCATTGACGGCATTACGTTGTTGATGCAAAAGCCACATACAAGCCTTGATGAATTGTTAGAAATTATTAAAGGCC
CTGACTTCCCTACTGGCGGAATTGTCCAAGGCTCAAACGGCATCCGCCAAGCTTATGAAACAGGGAAAGGCAAAATCGTC
GTTCGGGGCCGGACAGCGATTGAAGAAACGCGTGGCGGCCGCAAGCAAATCGTCATTACGGAAATTCCTTACGAAGTAGT
AAAGGCGAGCTTAGTTAAAAAAATGGATGAAATCCGATTTGACAAAAAAGTGGACGGTATTGCCGAAGTCCGCGACGATA
CAGACCGTACCGGGATGCGCATTGTCGTTGAACTGAAAAAGGAAGCTGATCCAGAAGCGATTCTCCATTACCTGTTTAAA
AATACCGATTTGCAAGTGACGTACCACTTTAATATGGTGGCGATACACAATAAAACACCTAAGTTAATGGGGCTGCTCGA
CTTGATGCAAGCGTACATCGACCATCAAAAGCAAGTGTTTACGCGACGCTCCCAATTCGAGCTTAAAAAAGCCGTTGACC
GCGCCCACATTGTCGAAGGTCTTATGAAAGCCGTTTCCATTTTGGATGAAGTCATTGCTGTGATCCGTGCTTCAAAAGAT
AAGAAAGACGCAAAAGCCAATTTGCAAAGCCAGTTTGGCTTTACTGAACCACAAGCAGAAGCAATTGTCACACTCCAACT
TTACCGTCTGACCAATACCGACATTACGACGCTTCAAAAAGAAGCAGAGGAGCTTGAAAAGCAAATTGCCGAATTAAAAG
CGATTTTGGCCAGCGAAAAGAAACTCATTTCCGTCATTAAAAAGGAATTAAACCAAATTAAAAAGACATTTGCTTCTCCG
CGCCGAACCGAAATTCGAGCGGAAATTGAAGAAATCAAAATCAACATGGACATGTTGATTGCCTCGGAAGACGTGCGCGT
GACGATCACAAAGGCAGGCTACGTCAAACGGACAAGCCTGCGCTCCTACTCAGCCTCTAGCCAGGATGGGCCAGGAATGA
AAGAAGGAGACCGTCTCTTATTATCCCAAGAAGCCAATACAACTGATGTGGTGCTATTGTTTACCAAACGGGGGAGTTAC
TTGTACGTGCCTGTCCACTCGCTGCCAGACATCCGTTGGAAAGACGACGGCCAACATGTTGCCAACCTCGTTGCGATTGA
TGCCGATGATGAAATTATTGCTGCGCAAATCATTCGCGAGTTTGCTGAGACGAAGTATTTGCTCTTTATGACGCGAGCAG
GAATGGCCAAACGGTCAACGTTAAACTTATACCAAGCCCAACGTTATTCCAAACCACTGATGGCCTTAAAGCTAAAAGAA
GGGGACGAAGTCGTTCGCGTGCTTTTGACAGACGGCCAGCAAGAACTGTTCGTAGCCACTGCTTTTGGGTATGGCCTTTG
GTTTTCGGAAGAAGATGTTTCTTTAGTCGGCCAACGTGCCGCTGGTGTAAAGGGAATCAATTTAAAAGAAGGCGATTACT
GCATTGGCGCCGAAGCATTTGGTCTTGAAGATTCTGTTGAATTTCTCGTTGCCACACACCGTGGAGCGGTCAAGAAAATG
GCCATTACTGAATTTGAAAAGTCAAGCCGCGCCAAACGAGGCGTGTTAATGCTAAGGGAATTAAAAAACAACCCTCATCG
ATTAGTTGGGCTCAAGCGGGTCCGCTCTCAAGATGAAACGTTTGCTATCGAAACGGCAAAAGGAGACATGATTGCCATCT
CGCCAAGGGACTATCGCCGTGCTGATCGCTATTCCAACGGCTCCTATGCTTTTGACCAACACGAAAGCGGCGACGCGCTT
ACGTTAGTACGTGTGATTCAATAA

>Flq|NC_011595.7059884|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGACCAGCCTTGCGCATCATGCGACAGAAAACCGCTCTGTAGCCGAATTTACTGAACAGGCTTACTTGAATTATGCCAT
GTACGTCATTATGGACCGTGCATTACCGCATATCAGTGATGGCTTAAAGCCCGTACAGCGCCGTATTGTCTATGCCATGA
GCGAGCTAGGCTTAAAAAGCAGTGGCAAGCCAAAAAAATCAGCGCGTACAGTGGGTGATGTACTTGGTAAATACCACCCA
CATGGTGACTCGGCATGTTATGAAGCCATGGTACTCATGGCTCAGCCATTTAGTTACCGCTATCCTTTAATCGAAGGTCA
GGGGAACTGGGGCTCACCTGATGATCCTAAGTCTTTTGCTGCGATGCGTTATACCGAAGCAAAACTCTCGGCTTATAGTG
AATTATTGCTGAGCGAATTAGGTCAGGGCACTAGCGAATGGCAAGATAACTTTGATGGTTCTTTAAAAGAACCGATCACT
TTACCTGCGCGTGTACCTAATATTCTTCTTAATGGTACGACAGGTATTGCTGTTGGGATGGCAACTGATATCCCGCCACA
TAATTTGCGTGAAGTTGTAAAAGGCACAATTGCTTTAATCCGTAATCCGCAAACCTCGGACGAAAAATTAGCTGAATATA
TTCCGGCTCCGGATTTACCAACCAAAGCTGAAATTATTACCCCGCCAGAAGAATTACTCAAAATCCAGACCACTGGTCGT
GGTAGTTATCGTATGCGAGCGGTATATACCATTGAGAAAAATGAAATTGTAATTACTGAGCTGCCATATCAAGTCTCTGG
TTCTAAGGTAATTACTCAAATTGCTGACCAGATGCAGGCTAAAAAGCTGCCATTAGTTGTCGACGTGCGTGATGAATCGG
ATCATGAAAACCCGACACGACTCGTGATTGTACTGCGCTCTAACCGTATTGATGCGGAAGCAGTGATGAGCCACTTATTT
GCGACCACCGATTTAGAATCAAGCTATCGTGTCAATTTGAACATGATTGGCGAAGATGGCCGTCCTCAGGTGAAATCAAT
TCGTCGTATTTTGCTTGAATGGATCGAGATCCGTAAAAAAACGGTAACTCGTCGTTTGCAGTACCATTTAAACCGTATTG
AAAAGCGCCTGCATATTTTGGCAGGTCTTTTAATTGCTTATCTCGATATTGATACAGTCATTCGTATTATTCGTGAAGAA
GACCAGCCTAAGCCAGTCTTGATGGAACACTTTAATATTGATGAGATACAGGCCGAGGCGATTTTAGAGCTTAAATTACG
TCATTTGGCAAAGCTTGAAGAGATGGAAATCCGTCATGAACAAGATGAACTTTCTGCGAAAGCTGCCATTATTCGTGAAC
AACTCGAAAATCCTGAATCTTTAAAAAACCTAATTATCAGTGAATTAAAAGAAGATGCGAAAAAGTTCGGTGATGAGCGC
CGTTCTCCAATTGTTGCACGTGCTGAAGCAGTTCAAATTAAAGAACAGGATTTAATGCCAGCTGAAACGGTAACGGTGGT
TTTGTCTGAAGCAGGCTGGGTTCGTGCGGCAAAAGGTGCGGATGTGGATGCCGAAAATCTCAACTACCGTGCTGGGGACC
AATATTTAAGTCATGCTGTCGGGAAAACCAATCAGCGAGTTTACTTCCTTGATGAAACAGGGCGCAGCTATGCCTTGCCA
ATTAGTAACTTACCTTCAGCGAGAGGCTTGGGGGATCCATTAAGTTCTAAATTATCACCAGCAAGTGGCGTATCGTTTAT
TCAGGTTTATTTAGATGATGATGAGTCTGAATTGATTGCTGCAAGTTCGGCAGGTTATGGTTTTAAAACGCAAACCAAGC
AATTAGATACCAATGCGAAAGCCGGTAAGACATTCTTAACGGTTCCGGATAAGGCAAAGGCTTTACCACTCATTTCTGCC
CAAAACATGACGCATTTGGCTGTACTGAGCTCAGCAGGGCGTTTGTTAATTTTAGATTTGGCAGAACTACCAAATTTAAA
TAAAGGTAAAGGTAATAAGTTGATACAACTTGAAGGCAAAGAGCAAATTTTATCCATGACAACCCTGAACTTAGATGAAA
TAATTCAGGTGGTTGCAGGTCAACAACATCTCAAATTAAAAGGTGATGATCTACAAAAATACATGGGTAAACGTGCTTCG
AAAGGTCAGCTCTTACCACGTGGATATCAAAAAGCAAATAAACTGTTGATTCAGAGATAA

>Flq|CP000675.2|gene3231|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PARC|RequiresSNPConfirmation
ATGAAGAAAATACCCAATATGAATGAAGTAACTGAAAAAAAACCGCTTACTGAGTTTACAGAAAAAGCTTATCTTGATTA
TTCAATGTATGTCATTTTGGACAGAGCATTACCGAGCATCGCAGATGGACTTAAGCCTGTTCAACGCAGAATTGTTTATG
CTATGTCTGAGTTGGGTCTGAAAGCAACAGCAAAATATAAAAAATCAGCGCGTACAGTAGGGGATGTTCTTGGTAAATTC
CATCCTCATGGTGATAGTGCATGCTATGAAGCTATGGTTTTAATGGCTCAACCTTTTTCATATCGCTATCCATTTGTTGA
TGGACAAGGAAATTGGGGATCCCCGGATGATCCCAAATCATTTGCTGCAATGAGGTATACAGAAGCAAGATTATCTCTTT
ATGCTGATGTGTTACTCGGAGAACTGCTACAAGGAACCGTGGATTGGGTAGATAATTTTGATGGTACTTTGCAAGAGCCC
GCTCTTTTACCCGCTCGTTTGCCTAATATTTTATTGAATGGTGCAACAGGTATAGCTGTTGGTATGGCTTCAGATATTCT
TCCGCACAATTTGACTGAAGTTGCTAATGCGTGTATTCATCTGCTGGATAACCCCCAAGCCGATATTAAGACTATTTGTG
AATATATTAAAGGTCCTGATTTTCCAACAGAAGCAGAAATCATTAGCCCTAGTGAAACAATTAGAGCTATGTACGAGTCC
GGTAATGGCTCAATTAAAATGCGAGCAATTTATGCTCAAGAAAAACAAAATATTGTCATAACAGCTTTACCTTATCAAGT
ATCCGGAGCCAGGGTAATGGAGCAAATCGCGTTGCAGATGCAACAGAAAAAATTACCGATGGTTGAGGATTTACGTGATG
AATCAGATCACGAGCATCCAACACGGTTGGTTATTATCCCCCGCTCTAATCGAGTAGATATAGAAAGTTTAATGTCGCAT
TTATTTGCTACCACGGATTTGGAGCGTAGCTATCGAGTTAATTTTAATATGATTGGTCTTGATGGCAAGCCACGAGTTAA
AGGACTGTTAGCAATCTTGACTGAATGGTTGGAATTTAGGCTTACCACAGTAAAAAGACGTCTTCAATTCAGATTGGAAA
AGGTACTGGAGCGTATTCATATTCTTGAAGGACTGCTTATTGCCTATCTTAATATAGATGAAGTCATTGCAATCATCAGA
GAACATGAGCAACCAAAACAAGGATTAATTTCACGCTTTAATTTAACCGAACGACAAGCTGAAGCAATATTGGAAATGAA
ACTGCGGCATTTAGCCAAATTGGAAGAGATTAAATTGCGTGGTGAACTGGATGAGCTGTCTGATGAACGTGATACTTTAC
AAAAAACGCTGGCTAGTCATTCTCTCTTAAAAGAACTGGTAAAAGAAGAGATAACGAAAGATCGAGATGAATTTGGTGAC
CCACGCCGTTCACCCATTATTACAAGGGAAGACTCTCAGGCATTAAAAGAAGAGGATATTTTGCCTAATGAACCTATCAC
GGTTGTATTGTCTAAAAATGGATGGGTCAGAGCGGCCAAGGGGCATGATGTCGATGGTAAGGAACTCAGCTATAAAGCTG
GAGATGAATTCAAAGCCCAAACGCTAGCTCGTACTAATCAGCAAGTTTTATTTTTTGATGGAGAGGGAAAGGTCTATTCG
CTTCCAGGACATGCATTGCCATCGGCACGTGGCCAAGGCGAGCCTTTGACTGGTAAATTAAACCCTGCTGAAGGAGTATT
GTTTGAAGCAATTGTTGGCGGAGAGCCTGAGCAAAAGGTGTTATTGGCTACCGATTCCGGGTATGGATTTATCGCCAAAA
TTGAAGATTTATATGTAAAAAATCGTAATGGAAAGGCATGCATCAAATTAAGTGAAAACAGTCATATATTGCCGCCAAGG
CTAATACCAAATCGAGAGCAATTATTTGTTGCTTGTGCGACTAATGTAGGGCGTTTACTGATTTTTTCTCTTGAGGAGTT
GCCCGAATTATCTCGAGGAAAAGGGAATAAATTGATCAGTATCCCTGTTGCTAAAGCGGTCTCACGAGAAGAGTATATAG
TTGATATGCAAGTTTTAACAACGAATGATTCGCTGACGGTTCATGCCGGTAAGCGGCATTTTACTCTGAAAGGTGAGGAT
TTGACTCACTATAAGGGTGAAAGGGGCAGGAGAGGAAACCGGTTGCCAAGAGGCTTACAAAATGTTTCTCAATTGCATGT
TACTCAATCTGAGTAA