MEGAResFrom MEG, the Microbial Ecology Group

ABES

The abeS gene encodes an SMR family efflux pump in Acinetobacter baumannii.

References

  • http://aac.asm.org/content/55/3/947.full

Other Groups in Drug and biocide SMR efflux pumps

Sequences

Download Sequences

>>MEG_374|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_SMR_efflux_pumps|ABES
ATGTCTTATCTTTATTTAGCAATTGCGATTGCTTGTGAAGTTATTGCAACTTCAGCATTAAAAGCATCTCAAGGTTTTAC
TGTTCCAATTCCGTCTATTATTACAGTTGTGGGTTATGCAGTTGCTTTTTATTTATTATCTCTTACGCTCAAAACAATTC
CAATCGGGATTGCCTATGCCATTTGGTCAGGCGCAGGTATTATTTTAATTTCTGCAATTGGCTGGATATTTTACAAACAA
CATTTAGACTTAGCTGCCTGCATTGGTTTAGCTTTAATGATCGCAGGCATTGTGATTATTAATGTGTTTTCTAAAAACAC
CCATCTA

>>MEG_375|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_SMR_efflux_pumps|ABES
ATGTCTTATCTTTATTTAGCAATTGCGATTGCTTGTGAAGTTATTGCAACTTCAGCATTAAAAGCATCTCAAGGTTTTAC
TGTTCCAATTCCGTCTATTATTACGGTTGTGGGTTATGCAGTTGCTTTTTATTTATTATCCCTTACGCTCAAAACAATTC
CGATCGGGATTGCCTATGCCATTTGGTCAGGCGCAGGTATTATTTTAATTTCTGCAATTGGCTGGATATTTTACAAACAG
CATTTAGACTTGGCTGCCTGCATTGGTTTAGCTTTAATGATTGCAGGCATTGTGATTATTAATGTATTTTCTAAAAACAC
CCATCTATAA

>>MEG_376|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_SMR_efflux_pumps|ABES
ATGTCTTATCTTTATTTAGCAATTGCGATTGCTTGTGAAGTTATTGCAACTTCAGCATTAAAAGCATCTCAAGGTTTTAC
TGTTCCAATTCCGTCTATTATTACGGTTGTGGGTTATGCAGTTGCTTTTTATTTATTATCTCTTACGCTCAAAACAATTC
CGATCGGGATTGCCTATGCCATTTGGTCAGGCGCAGGTATTATTTTAATTTCTGCAATTGGCTGGATATTTTACAAACAG
CATTTAGACTTGGCTGCCTGTATTGGTTTGGCTTTAATGATCGCAGGTATTGTGATTATTAATGTGTTTTCTAAAAACAC
CCATCTATAA

>>MEG_377|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_SMR_efflux_pumps|ABES
ATGTCTTATCTTTATTTAGCAATTGCGATTGCTTGTGAAGTCATTGCAACTTCAGCTTTAAAAGCATCTCAAGGTTTTAC
TGTTCCAATTCCGTCTATTATTACGGTTGTGGGTTATGCAGTTGCTTTTTATTTATTATCTCTTACGCTCAAAACAATTC
CGATCGGGATTGCCTATGCCATTTGGTCAGGCGCAGGTATTATTTTAATTTCTGCAATTGGCTGGATATTTTACAAACAG
CATTTAGACTTAGCTGCCTGCATTGGTTTAGCTTTAATGATCGCAGGCATTGTGATTATTAATGTGTTTTCTAAAAACAC
CCATCTATAA

>>MEG_378|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_SMR_efflux_pumps|ABES
ATGTCTTATCTTTATTTAGCAATTGCGATTGCTTGTGAAGTTATTGCAACTTCAGCATTAAAAGCATCTCAAGGTTTTAC
TGTTCCAATTCCGTCTATTATTACGGTTGTGGGTTATGCAGTTGCTTTTTATTTATTATCTCTTACGCTCAAAACAATTC
CGATCGGGATTGCCTATGCCATTTGGTCAGGCGCAGGTATTATTTTAATTTCTGCAATTGGCTGGATATTTTACAAACAG
CATTTAGACTTGGCTGCCTGCATTGGTTTAGCTTTAATGATTGCAGGCATTGTGATTATTAATGTGTTTTCTAAAAACAC
CCATCTATAA

>>MEG_379|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_SMR_efflux_pumps|ABES
ATGTCTTATCTTTATTTAGCAATTGCGATTGCTTGTGAAGTTATTGCAACTTCAGCATTAAAAGCATCTCAAGGTTTTAC
TGTTCCAATTCCGTCTATTATTACAGTTGTGGGTTATGCAGTTGCTTTTTATTTATTATCTCTTACGCTCAAAACAATTC
CAATCGGGATTGCCTATGCCATTTGGTCAGGCGCAGGTATTATTTTAATTTCTGCAATTGGCTGGATATTTTACAAACAA
CATTTAGACTTAGCTGCCTGCATTGGTTTAGCTTTAATGATCGCAGGCATTGTGATTATTAATGTGTTTTCTAAAAACAC
CCATCTATAA

>>MEG_380|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_SMR_efflux_pumps|ABES
ATGTCTTATCTTTATTTAGCAATTGCGATTGCTTGTGAAGTTATTGCAACTTCAGCATTAAAAGCATCTCAAGGTTTTAC
TGTTCCAATTCCGTCTATTATTACGGTTGTGGGTTATGCAGTTGCTTTTTATTTATTATCTCTTACGCTCAAAACAATTC
CGATCGGGATTGCCTATGCCATTTGGTCAGGCGCAGGTATTATTTTAATTTCTGCAATTGGCTGGATATTTTACAAACAA
CATTTAGACTTAGCTGCCTGCATTGGTTTAGCTTTAATGATCGCAGGCATTGTGATTATTAATGTGTTTTCTAAAAACAC
CCATCTATAA