MEGAResFrom MEG, the Microbial Ecology Group

MEXZ

Resistance to aminoglycoside antibiotics can be conferred via overexpression of the MexXY-OprM efflux pump. This has been described via loss-of-function mutations in the MexZ gene, which is a repressor of the mexXY operon, resulting in overexpression of the pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/24145539

Other Groups in Drug and biocide RND efflux regulator

Sequences

Download Sequences

>>MEG_3941|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|MEXZ|RequiresSNPConfirmation
GTGGCCAGGAAAACCAAAGAGGAATCCCAGAAAACCCGCGACGGCATACTCGATGCCGCCGAGCGGGTTTTCCTGGAAAA
GGGCGTGGGCACCACTGCCATGGCCGACCTGGCGGACGCCGCCGGGGTTTCTCGCGGTGCGGTCTACGGCCACTACAAGA
ACAAGATCGAGGTCTGCCTGGCGATGTGCGACCGCGCCTTCGGCCAGATCGAGGTACCCGACGAAAACGCCAGGGTGCCG
GCGCTGGATATCCTCCTGCGCGCCGGCATGGGCTTTCTCCGCCAGTGCTGCGAGCCCGGTTCGGTGCAGCGGGTGCTGGA
GATCCTCTACCTCAAGTGCGAACGCAGCGACGAGAACGAGCCGCTGTTGCGCCGCCGCGAGCTGCTCGAGAAGCAGGGGC
AACGCTTCGGCCTCCGGCAGATCCGCCGGGCGGTGGAACGCGGCGAACTGCCGGCGCGGCTGGACGTCGAGCTGGCCAGC
ATCTATCTGCAATCGCTCTGGGACGGCATCTGCGGCACCCTGGCCTGGACCGAGCGCCTGCGCGACGATCCCTGGAACCG
CGCCGAACGCATGTTCCGCGCCGGCCTCGACAGCCTGCGCAGTTCTCCCTACCTGTTGCTGGCGGACGCCTGA