MEGAResFrom MEG, the Microbial Ecology Group

TETY

The tetY gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Drug and biocide MFS efflux pump

Sequences

Download Sequences

>MEG_7257|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETY
ATGTCAAAATCACTTATAACCGCACTCATTGTTGTCGCGCTTGATGCGATTGGTTTGGGATTAATCATGCCGGTGGTTCC
GGCTTTATTAAATGAATTTGTACCGGCAGAGCAAACAGCATTTCACTATGGTGTTTTTTTATCGCTTTATGCGTTTATGC
AGGTCTTTTGCGCGCCCGTTTTAGGGCGGTTATCTGACCGCTATGGACGGCGGATTATTTTGCTGGTTTCATTTTTAGGT
GCCACGATTGATTATAGCATAATGGCGGCAGCGCCTGTTTTATGGGTGCTTTATATCGGCCGGATCATCTCAGGTGTTAC
CGGAGCAACTGGTGCAATCGCGGCATCAATTATCGCTGATACAACTAAACAGGAAGAACGTGCGCGTTGGTTTGGTTTTA
TGGGGGCGTGTTTTGGTGCAGGTATGATTGCAGGGCCTGCTATTGGCGGTGTTCTTGGTGATATATCTGTGCATGCGCCC
TTTGTGGCAGGGGCTCTTCTCAATGCAATTGCTTTTTGTTTGGTGGCTTTCTTGTTGCCCAAAGCGTCGTCACAACCGCC
CGAAGGGCAGCCAGCCAAAATCAATTTGTTTGAAGGTTTTCGTTTCAATTTTGCAGTTCAGGGACTTACCAGCTTTTTTG
CGTTGTTTTTTCTTATGCAGCTGATCGGGCAGGCGCCCGCCGCTCTGTGGGTGATTTATGGCGAACAGCGCTTGAATTGG
GATATTGGCACAGCAGGTGTGTCGCTGGCCATTTTTGGTGCAGCACATACATTCGTACAAGCTGTTTTAACCGGCACTCT
TTCAAAGCGACTGGGCGACCGCGGTGTGTTGCTGCTTGGTATGGGCGCTGATATTTGCGGGTTTCTATTGCTGGCTTTTA
TCACGCAAAGCTGGATGGTTCTGCCGGCAATTTTCATGCTGGCTACAGGCGGCATTGGTATGCCTGCTTTGCAGGCTATT
ATTTCCGGTCTTGTTCGTGATGAAAAGCAAGGTGCTTTACAAGGAACTTTAACAGGCTTGACGAATATAACTTCGATCAT
CGGGCCGGTCGGATTTACGACGCTTTATGGCTTAACCGCGGGGCGGTGGGATGGTTGGGTTTGGCTCGTCGCAGCAAGTC
TTTATTTTATAGCTATACCATTATTGCGCCAGTCAGCCAGTTTGTTACGATCTTAA

>MEG_7258|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETY
ATGTCAAAATCACTTATAACCGCACTCATTGTTGTCGCGCTTGATGCGATTGGTTTGGGATTAATCATGCCGGTGGTTCC
GGCTTTATTAAATGAATTTGTACCGGCAGAGCAAACAGCATTTCACTATGGTGTTTTTTTATCGCTTTATGCGTTTATGC
AGGTCTTTTGCGCGCCCGTTTTAGGGCGGTTATCTGACCGCTATGGACGGCGGATTATTTTGCTGGTTTCATTTTTAGGT
GCCACGATTGATTATAGCATAATGGCGGCAGCGCCTGTTTTATGGGTGCTTTATATCGGCCGGATTATCTCAGGTGTTAC
CGGAGCAACTGGTGCAATCGCGGCATCAATTATCGCTGATACAACTAAACAGGAAGAACGTGCGCGTTGGTTTGGTTTTA
TGGGGGCGTGTTTTGGTGCAGGTATGATTGCAGGGCCTGCTATTGGCGGTGTTCTTGGTGATATATCTGTGCATGCGCCC
TTTGTGGCAGGGGCTCTTCTCAATGCAATTGCCTTTTGTTTGGTGGCTTTCTTGTTGCCCAAAACGCCGTCACAACCGCC
TGAAGGACAGCCAGCCAAAATCAATTTGTTTGAAGGCTTTCGCTTCAATTTTGCAGTTCAGGGACTTGCCAGCTTTTTTG
CGTTGTTTTTTCTTATGCAGCTGATTGGGCAGGCGCCCGCCGCTTTGTGGGTGATTTATGGCGAACAGCGCTTGAATTGG
GATATTGGCACAGCAGGTGTGTCGCTGGCCGTTTTTGGTGCAGCACATACATTCGTACAAGCTGTTTTAACCGGCACTCT
TTCAAAGCGACTGGGTGACCGCGGTGTGTTGCTGCTTGGAATGGGCGCTGATATGTGCGGGTTTTTATTGCTGGCTTTTA
TCACGCAAAGCTGGATGGTTCTGCCGGCAATTTTTATGCTGGCCACAGGCGGCATTGGTATGCCTGCTTTGCAGGCCATT
ATTTCAGGTCTTGTTTGCGATGAAAAACAAGGTGCTTTACAGGGAACTTTAACGGGGTTGACGAATATAACCTCGATTAT
CGGGCCGGTCGGATTTACGACGCTTTATGGCTTAACCGCGGGGCAGTGGGATGGTTGGGTTTGGCTCGTCGCAGCAAGCC
TTTATCTTATTGCTATACCATTATTGCGCCAGTCAGCCAGTTTATTGCGATCTTAA