MEGAResFrom MEG, the Microbial Ecology Group

TETB

The tetB gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Drug and biocide MFS efflux pump

Sequences

Download Sequences

>MEG_7049|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccacttaggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagcgcatttgcctttttagcgt
tcatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaacaatgcaaccggtat
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>MEG_7050|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccacttaggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaacaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>MEG_7051|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
agggtatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcgctttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattatttgtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcactcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>MEG_7052|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcgaatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagatttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatgagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>MEG_7053|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaacaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>MEG_7054|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>MEG_7055|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagtggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagtttttcctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>MEG_7056|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
atgaatagttcgacaaagatcgcattggtaattacgttattcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccacaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>MEG_7057|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
atgaatagttcgacaaagatcgcattggtaattacgttattcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>MEG_7058|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
atgaatagttcgacaaagatcgcattggtaattacgttattcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggttattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaaaccgacaagatc
caagaatga

>MEG_7059|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
ATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAACTTATTGCTTCGGAAGATATCGCTAACCACTTAGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCACTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGGATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGTTTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATCAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTAACAATGCAACCGGTGT
TATTGGCCCATTACTGTTTGCTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG

>MEG_7060|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
ATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAATTTATTGCTTCGGAAGATATCGCTAACCACTTTGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCACTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGAATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGATTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATGAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTACCAATGCAACCGGTGT
TATTGGCCCATTACTGTTTACTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG

>MEG_7061|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
ATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAATTTATTGCTTCGGAAGATATCGCTAACCACTTTGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCGCTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGGATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGTTTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATCAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTACCAATGCAACCGGTGT
TATTGGCCCATTACTGTTTGCTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG

>MEG_7062|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
ATGAATAGTTCGACAAAGATCGCATTGGCAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAATTTATTGCTTCGGAAGATATCGCTAACCACTTTGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCACTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGGATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGTTTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATCAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTAACAATGCAACCGGTGT
TATTGGCCCATTACTGTTTGCTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG

>MEG_7063|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
ATGAGCAGCTCCATGATTCAGCCTGGGACGGAACGTCAGCTTAAGAACCGCACGAGTTTGGGTCAGACGGTCCGAAATTC
GTTGACGATGGCTTACCGCGGGCTGCTGAAGCTCCGGCGCACGCCCGAGCAGTTGTTTGACGTCACGTTTCAGCCCATTA
TTTTTACGCTGATGTTCACCTATATTTTTGGGGGCGCCATCTCGGGTGACGTGGCGAGTTATTTGCCCGTCATCATTCCC
GGCATCCTCGTCCAGACCGTGATTACGACCTCCGTCGTCACAGGCGTTCAGCTGCGCGAGGATATGGATAAAGGCGTATT
CGACCGATTCAAATCGCTGCCGATTGCACGCATCGCACCGCTGGCGGGTGCCCTGCTGGCAGACACGATTCGGTATACCA
TTGCGACAGTGCTTACCTTTACGATGGGATATATTATGGGGTATCGGCCCGAGGGCGGCTTGGGTTATGTTGCTCTTGCG
GGGTTGGTCGTCATTTTGTGCTCATGGGCCATTAGCTGGATTTTTGCTTTCTGCGGCGTGATTGCAAGATCTGCCTCCGG
CGTGCAGGGGATATCGATGATCGTGCTGTTTCCGCTCACGTTTCTCTCCAACGCGTTCGTGCCGGTGGATACGATGCCGG
GCTGGCTGCAGTGGTTCGTCAATATGAATCCGATCTCGCATCTTGTGACAGCCGTTCGGGATCTCACCAACGCTGGCACC
GTGGGCTGGGATCTCACGATATCCTTGGTTGGCGCCGCGGTTATCGTGGCGATCTTTGCTCCCATTACGGTTCGTGCGTA
CATGCGCCGCACTTGA

>MEG_7064|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETB
ATGGTTAATAAACTTTCAGCATATAAAACTTATTTATTATTTTCAGCTATTACAGCAATGTGTTTTTCGTTAGTAGCTAC
AGTTATGATGGTGTATCACATTGAAATAGTTCATTTAAATCCACTTCAGCTTATACTTGTTGGAACTACTTTGGAATTAG
CATGCTTTATATTTGAAATTCCTACAGCTATAGTTGCAGATGTGTATAGTCGTAAACTATCTATTGTTATTGGGGGAGTT
TTAACAGGAGTGGGATTTATTTTAGAAGGTTCTATTTCTAGTTTTGTTTTCGTACTTGTAGCACAGATTGTATGGGGATT
AGGGTCTACTTTTATCAGTGGCTCGCTTGAAGCTTGGATTGCGGAAGAAGAGAAGAATAAAGATTTAGATGAAATTTATA
TAAAGGGAGCACAAGCAGGGCAGATAGGAGCATTTATTGGAATAGTACTAAGCACTGTAATAGCTAATTTCTCTGTAAGG
CTTCCTATTATAGTTAGTGGAGTTTTATTTATAATTCTTGCATTATTTTTATGGTTATATATGCCAGAAAATAATTTTAA
ACCATCTGCTCCTGGGGATTTAAATACATTCAAAAAGATGGTATATACATTTAAATCTGGTCTTAAATTTGTAAAAAGTA
AATCTATAATTATGATTTTACTTGCAGTAACTTTATTTTATGGATTATCAAGTGAAGGTTATGATAGACTTTCTAATGCG
CATTTTTTACAAGATACTACACTTCCTAAACTTGGAAACCTTAGTTCAGTGACTTGGTTTGGAATTTTTGGAATTTTAGG
AATGATATTGAGCTTCATAGTAATGCATTTTATGGCAAAGAATCTTAAGAATGAGGATAATAGGAAAAATGGAAAACTAT
TATTATGCATAAATATACTTTATATATCGTCTATGTTGATATTTGCTCTTACAAGAAACTTTAGTTTAATGTTAATAGCT
TATTTGGCAACAAATACCTTTAGAATTATAAATAAACCTATATTCAGTGCGTGGTTAAATGGGCATATAGATGATAATTC
TAGAGCTACTGTGCTTTCTATAAATGGACAAATGAATTCCTTAGGTCAAATTTTAGGTGGACCGATTATAGGAATCATAG
CTACAAATATTTCAGTAAGTATTGGTATAGTATGTACTTCGTTATTAGTAACACCGGTATTAGTGTTATATATTGTTGCT
ATGATAATTGATAAAAAGGTGGATGATAGAGTTGGAGGTATTGATTATGAAGAAAATAATTAA