MEGAResFrom MEG, the Microbial Ecology Group

ARNA

The arnA gene encodes an enzyme with dehydrogenase and transformylase domain that participate in Lipid A modification and resistance to polymyxin B.

References

Other Groups in Lipid A modification

Sequences

Download Sequences

>CARD|phgb|U00096|2368038-2370021|ARO:3002985|arnA|Cationic_antimicrobial_peptides|Lipid_A_modification|ARNA
ATGAAAACCGTCGTTTTTGCCTACCACGATATGGGATGCCTCGGTATTGAAGCCCTGCTGGCTGCCGGTTACGAAATTAG
CGCCATTTTTACCCATACTGATAATCCCGGTGAAAAAGCCTTTTATGGTTCGGTGGCTCGTCTGGCGGCGGAAAGAGGCA
TTCCGGTTTATGCGCCGGATAACGTTAATCATCCGCTGTGGGTGGAACGCATTGCCCAACTGTCGCCAGATGTGATTTTC
TCTTTTTATTATCGCCATCTTATTTACGACGAAATTTTGCAGCTCGCTCCCGCAGGTGCATTTAATCTGCATGGTTCGCT
GTTACCAAAATATCGTGGTCGCGCGCCGCTGAACTGGGTGCTGGTCAACGGTGAAACGGAAACTGGCGTTACATTGCACC
GAATGGTGAAACGTGCCGATGCCGGGGCCATTGTGGCGCAACTGCGCATTGCCATTGCGCCAGACGATATCGCTATTACG
CTGCATCATAAATTGTGCCATGCCGCGCGCCAGCTACTGGAACAGACATTACCCGCCATTAAACACGGTAATATTCTGGA
AATCGCCCAGCGCGAAAACGAAGCCACCTGTTTTGGTCGCAGAACGCCGGATGACAGTTTCCTTGAATGGCATAAACCGG
CATCCGTACTGCACAACATGGTACGTGCCGTTGCCGATCCGTGGCCGGGTGCCTTCAGCTATGTTGGCAATCAGAAATTC
ACCGTCTGGTCGTCGCGTGTTCATCCTCATGCCAGCAAAGCACAGCCGGGGAGCGTGATTTCTGTTGCGCCACTGCTGAT
TGCCTGTGGCGATGGCGCGCTGGAAATCGTCACCGGACAGGCGGGCGACGGCATTACTATGCAGGGCTCGCAATTAGCGC
AGACGCTGGGCCTGGTGCAAGGTTCACGCTTGAATAGCCAGCCTGCCTGCACCGCCCGACGCCGTACCCGGGTACTCATC
CTCGGGGTGAATGGCTTTATTGGCAACCATCTGACAGAACGCCTGCTGCGCGAAGATCATTATGAAGTTTACGGTCTGGA
TATTGGCAGCGATGCGATAAGCCGTTTTCTGAATCATCCGCATTTTCACTTTGTTGAAGGCGATATCAGTATTCATTCCG
AATGGATTGAGTATCATGTCAAAAAATGTGATGTCGTCTTGCCGCTGGTGGCGATAGCCACGCCGATTGAATATACCCGC
AACCCGCTGCGCGTATTTGAACTCGATTTTGAAGAGAATCTGCGCATTATCCGCTACTGCGTGAAGTACCGTAAGCGAAT
CATCTTCCCGTCAACTTCAGAAGTTTATGGGATGTGTAGCGATAAATACTTCGATGAGGACCATTCTAATTTAATCGTCG
GCCCGGTGAATAAACCACGCTGGATTTATTCGGTATCAAAACAATTACTTGATCGGGTGATCTGGGCCTATGGCGAAAAA
GAGGGTTTACAGTTCACCCTCTTCCGCCCGTTTAACTGGATGGGACCACGACTGGATAACCTTAATGCAGCGCGAATTGG
CAGCTCCCGCGCTATTACGCAACTCATTCTCAATCTGGTAGAAGGTTCACCGATTAAGCTGATTGATGGCGGAAAACAAA
AACGCTGCTTTACTGATATTCGCGATGGTATCGAGGCGTTATACCGCATTATCGAAAATGCGGGAAATCGCTGCGACGGT
GAAATTATCAACATTGGCAATCCTGAGAACGAAGCGAGCATTGAGGAACTGGGCGAGATGCTGCTGGCGAGCTTCGAAAA
ACATCCGCTGCGCCATCATTTCCCACCGTTTGCGGGCTTTCGCGTTGTCGAAAGTAGCAGCTACTACGGCAAAGGATATC
AGGACGTAGAGCATCGTAAACCGAGCATCCGCAATGCCCACCGCTGCCTGGACTGGGAGCCGAAAATTGATATGCAGGAA
ACCATCGACGAAACGCTGGATTTCTTCCTGCGCACCGTTGATCTTACGGATAAACCATCATGAC

>CARD|phgb|NC_002516.2|3982020-3984009|ARO:3002985|arnA|Cationic_antimicrobial_peptides|Lipid_A_modification|ARNA
ATGACCTCGAAAGCCGTCGTCTTCGCCTACCACGACATCGGTTGCACCGGTATCGAAGCCCTGCTCAATGCCGGCTACGA
GATCGCCGCCGTCTTCACCCATGCCGACGACCCACGGGAAAACACCTTCTACGCCTCGGTCGCACGCCTCTGCGCCGAGC
GCGGCATTCCGCTGCACGCGCCCGAGGACGTGAACCATCCGCTGTGGCTGGAGCGTATCCGCCAACTGCGCCCGGACTTC
CTGTTCTCCTTCTACTACCGCCGCCTGCTCGGCGCCGAGCTGCTCGCCTGCGCCGCACGCGGCGCCTACAACCTGCACGG
TTCGCTGCTGCCGCGCTACCGCGGACGCGCCCCGGCGAACTGGGTGCTGGTCAACGGCGAAACGCAGACCGGGGTGACCC
TGCATCGCATGATCGAGCGCGCCGACGCCGGGCCGATCCTCGCCCAGCAGGCCGTCGCCATCGACCCCGAGGACACCGCC
CTGAGCCTGCACGGCAAGCTGCGCAAGGCCGCCGGCGCCCTGCTGCGCGACAGCCTGCCGCTGCTCGCCCTCGGCGTGCT
GCCGGAAGTCGAGCAGGACGAGAGCCAGGCCAGCCACTTCGGCCGGCGCACCCCGGCGGACGGCCTGCTCGACTGGCACA
GGCCGGCACGGCAGTTGTACGACCTGGTGCGCGCGGTGACCCAGCCCTACCCTGGCGCCTTCTGCCAGGTCGGCGAACAG
AAGCTGATCGTCTGGAGCGCCGAGGTGGTCGCCGGCAACCACGGCCGCGAGCCGGGCAGCGTACTGTCCTGCGACCCGCT
GCGGATCGCCTGCGGCGAGGACTCGCTGGTGCTGCGCTTCGGCCAGCGCGGCGAGCGCGGCCTGTACCTGGCCGGCACGC
AACTGGCCACCGAGCTGGGCCTGGTCGAGGGCGCGCGCCTGCGTGGCGCGGCATGCAGTCCGCAGCGCCGCACGCGGGTG
CTGATCCTCGGGGTCAACGGCTTCATCGGCAACCACCTGTCCGAACGCCTGCTGCGCGACGGTCGCTACGAGGTCCACGG
CATGGACATCGGCTCCGACGCCATCGAACGGCTCAAGGCCGACCCGCATTTCCACTTCGTCGAAGGCGACATCGGCATCC
ATTCGGAGTGGCTCGAATACCATGTGAAGAAATGCGACGTGATCCTGCCGCTGGTGGCCATCGCCACGCCCATCGAGTAC
ACGCGCAACCCGCTGCGGGTGTTCGAACTGGACTTCGAGGAAAACCTGCGGATCGTCCGCTACTGCGTGAAATACGGCAA
ACGCGTGGTGTTCCCTTCCACCTCCGAGGTCTACGGCATGTGCCAGGACCCGGACTTCGACGAAGACCGCTCGAACCTGG
TGGTCGGGCCGATCAACAAGCAGCGCTGGATCTACTCGGTGTCCAAGCAGTTGCTCGACCGGGTGATCTGGGCCTACGGC
CAGCAGGGCCTGCGCTTCACCCTGTTCCGTCCGTTCAACTGGATGGGCCCGCGCCTGGACCGCCTGGATTCGGCGCGGAT
CGGCAGCTCGCGGGCGATCACCCAGCTCATCCTGCACCTGGTCGAAGGCACGCCGATCCGCCTGGTCGACGGCGGCGCGC
AGAAGCGCTGCTTCACCGACGTCGACGACGGCATCGAGGCCCTCGCGCGGATCATCGACAACCGCGACGGCCGCTGCGAC
GGGCAGATCGTCAACATCGGCAACCCGGACAACGAGGCGAGCATCCGCCAGCTCGGCGAGGAACTGCTGCGCCAGTTCGA
GGCCCACCCGCTGCGCGCGCAGTTCCCGCCCTTCGCCGGCTTCCGCGAGGTGGAGAGCCGCAGCTTCTACGGCGACGGCT
ACCAGGACGTGGCCCACCGCAAGCCGAGCATCGACAACGCCCGGCGCCTGCTCGACTGGCAGCCCACCATCGAACTGCGC
GAGACCATCGGCAAGACCCTCGACTTCTTCCTCCACGAAGCGCTCCGCGAGCGCGAGGCACAGGCGTGA