MEGAResFrom MEG, the Microbial Ecology Group

MEXZ

Resistance to aminoglycoside antibiotics can be conferred via overexpression of the MexXY-OprM efflux pump. This has been described via loss-of-function mutations in the MexZ gene, which is a repressor of the mexXY operon, resulting in overexpression of the pump.

References

Sequences

Download Sequences

>CARD|pvgb|NC_002516.2|2212676-2213309|ARO:3003709|mexZ|Aminoglycosides|Aminoglycoside-resistance_regulator_mutation|MEXZ|RequiresSNPConfirmation
GTGGCCAGGAAAACCAAAGAGGAATCCCAGAAAACCCGCGACGGCATACTCGATGCCGCCGAGCGGGTTTTCCTGGAAAA
GGGCGTGGGCACCACTGCCATGGCCGACCTGGCGGACGCCGCCGGGGTTTCTCGCGGTGCGGTCTACGGCCACTACAAGA
ACAAGATCGAGGTCTGCCTGGCGATGTGCGACCGCGCCTTCGGCCAGATCGAGGTACCCGACGAAAACGCCAGGGTGCCG
GCGCTGGATATCCTCCTGCGCGCCGGCATGGGCTTTCTCCGCCAGTGCTGCGAGCCCGGTTCGGTGCAGCGGGTGCTGGA
GATCCTCTACCTCAAGTGCGAACGCAGCGACGAGAACGAGCCGCTGTTGCGCCGCCGCGAGCTGCTCGAGAAGCAGGGGC
AACGCTTCGGCCTCCGGCAGATCCGCCGGGCGGTGGAACGCGGCGAACTGCCGGCGCGGCTGGACGTCGAGCTGGCCAGC
ATCTATCTGCAATCGCTCTGGGACGGCATCTGCGGCACCCTGGCCTGGACCGAGCGCCTGCGCGACGATCCCTGGAACCG
CGCCGAACGCATGTTCCGCGCCGGCCTCGACAGCCTGCGCAGTTCTCCCTACCTGTTGCTGGCGGACGCCTGA