MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

MECA

The mecA gene and its homologues, mecB and mecC, encode PBP2a, which is part of the SCCmec resistance island. The PBP2a has a lower affinity for beta-lactam antibiotics and retains wild-type function of the PBPs, therefore causing resistance to beta-lactams. MecA is often present with its regulators MecR1 and MecI in the mec gene complex IS431-mecA-mecR1-mecI, however variants of this complex exist where mecR1 has been deleted or the genes are in a different order.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3780952/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Penicillin binding protein

Sequences

Download Sequences

>>MEG_3766|Drugs|betalactams|Penicillin_binding_protein|MECA
atgaaaaaaataataattgctctactcattttgatagttgcagctgccggcgttggtacatatttttatgcttcaaaaga
taaaaaaattaatgaaactgttgatgcaattgaagataaaaatttcaaacaagtttataaagatagcacttatcgttcta
aaaatgataacggcgaagtagaaatgactgaccgcccgataaaaatttatgaaagtttaggcgttaaagatataaatatt
caggatcgtaaaataaagaaagtatctaaaaataaaaagcaagttgatgctcaatataaaatcaaaacaaactacggtac
catcgaccgcaatgttcgatttaatttcgttaaagaagatggtaaatggaaattagattggaatcaaagcgtcattattc
cagacatgcagaaagatcaaagcattcatatcgaaccagttaagtcggaacgcggtaaaattttagacagaaacaacgta
gaattggccaatacaggaacagcacatgagataggcattgttccaacgagtgtgtctaaagaagactataaagcaatcgc
tcaaaaactaagtatttcagaagatcatattaaccaacaaatgaaccaagattgggttcaagatgatacattcgttccac
ttaagaccgttaaaacaatggataaagatttaagtgatttcgtaaaaaaacatcatcttacaactaatgaaacagaaagt
cgcaactatcctctagaaaaagcgacgtcacatttattaggttatgttggcccaattaactctgaagaattaaagaagaa
agaatttaaaggttatgaagatgatgctgtcgttggtaaaaaaggactcgaaaaactttatgataaaaagctccaacata
aagatggctatcgtgtcactatcatggacgataatagcaataaagtcgcacatacattagtagagaaaaagaaaaaagat
ggcaaagatattcaactgactattgatgctaacgttcaaaaaagcatttataacaacatgaaaaatgattatggctcagg
tactgctattcacccacaaacaggagaattgttagcacttgtaagcacgccttcatacgacgtatatccatttatgaatg
gtatgagcgacgaagcatataaaaaattaaccgaagataaaaaagaaccactgctcaacaagttccagatcacaacttca
ccaggctcaactcaaaaaatattaacagcaatgattggattaaataacaaaacattagacgatcaaacaaattataagat
taatggtaaaggctggcaaaaagataaatcttggggtgattataacgttacaagatatgaagtggtaaatggtaatatcg
acttaaaacaagcaatagaatcatcagataacattttctttgctagagtagcactcgaattaggaagtaagcaatttgaa
aaaggcatgaaaaaactaggtgttggtgaagacataccaagtgattacccattctataatgcacaaatttcaaacaaaga
tttagataatgaaatattgttagcagattcaggttacggacaaggtgaaatactgattaacccagtacaaatcctttcaa
tctatagcgcattagaaaataacggcaatattaacgcaccacacgtattaaaagacacgaaaaacaaagtttggaagaaa
aatattatttccgcggaaaatatcaatctattaacagacggcatgcaacaagtcgtaaacaaaacacatagagaagatat
ttatagaccatacgcaaacttagttggtaaatccggaacagcagaactcaaaatgaaacaaggcgaaacaggcagacaga
ttggttggtttatatcttatgataaagacaatccaaatatgatgatggccattaatgttaaagatgtacaagataaaggc
atggcgagttacaacgccaaaatctcaggtaaagtttatgatgacctatacgagaacggtgataaaaaattcgatataga
taaataa

>>MEG_3767|Drugs|betalactams|Penicillin_binding_protein|MECA
atgaaaaaattaatcatagccatcgtggttgtaatcattgttgtagcttcaagcatatttttttatgcatcaaaaaacag
ccaaataaacgatacactagatgccattgaagacaaaaatgttaagcaagtgttcaaagatagtacttaccaatctaaaa
atgataatggcgaagtggaaatgacagaccgccctattaagatttatgacagtctaggtgtcaaagctatcaacattaaa
gatcgtgatatcaaaaaggtttcaaaaaacaaaaaacaagtcactgcaaaatatgaactgcaaacaaattacggcaaaat
taatcgtgacgttaaattaaactttattaaagaagataaagattggaaattagattggaatcaaagtgtcatcattccag
gcatgcagaaaaatcaatccatcaatattgaaccattgaaatcagaacgaggtaagattttagaccgaaataatgtagaa
ttagccactacaggaacagcacatgaagttggcattgttcctaataatgtttcgacaagtgattacaaagcaatcgctga
aaaattagacctttcagaatcgtatattaaacaacaagctgaacaggattgggttaaagatgatacattcgtccctctca
agactgttcaaaatatgaatcaagacacaaagcgttttgttgaaaagtatcatctcacaacacaagaaacagaaagtcga
cagtatccgcttgaagaagcaacaacgcacttgcttggttatgttggccctattaactcagaagaattaaagcaaaaagc
atttaaaggttataaaaaagatgccatcgtcggtaaaaaaggaatcgaaaaactttacgataaagaccttcaaaataaag
acggatatcgggtcacaataattgataataataaagttattgatacattaataaagaaaaagaaaaaagatggcaaagat
attaaattaaccatcgattctagagtccaaaaaagtatttataacaacatgaaagatgactacggttcaggtacagctat
tcatccacaaacaggcgaactgttagcacttgtcagcacaccatcttacgatgtttatccatttatgaatggaatgagtg
atgaagattataagaaattaacggaagatgataaagaaccacttcttaataagttccaaatcacgacatcacctggttcg
actcaaaaaatattaacagctatgattggcttaaataataagactttagacgacaaaacaagttataaaattaacggaaa
aggatggcaaaaagataaatcttggggtgactacaacgttacaagatatgaagttgttaatggtgatatcgatttaaaac
aagctattgaatcatcagataatatcttctttgcgagagttgcacttgaattaggaagcaaaaaattcgaagaaggtatg
aaacgtctaggcgttggtgaagatatcccgagtgattatccattctataatgcacaaatttcaaataagaacttagataa
tgaaatattgttagctgactcaggttatggacaaggcgaaatattgattaatcctgttcaaattctttcaatatatagcg
cattagagaataaaggtaatgtaaatgcaccacatgtactcaaagatacgaaaaataaagtctggaagaagaacatcatt
tcccaggaaaatattaaattgttaacagacggcatgcaacaagtcgtgaacaaaacacatagagaagatatttatagatc
atatgccaacttagttggtaaatcaggcacagctgaactcaagatgaaacaaggtgagacaggacaacaaataggttggt
tcatttcttataataaagataatccaaatatgatgatggctattaatgtgaaagatgtacaagataaaggtatggcaagt
tacaatgccaaaatatctggaaaagtgtatgacgatttatatgataacggtaagaaaacatataatattgataaataa

>>MEG_3768|Drugs|betalactams|Penicillin_binding_protein|MECA
atgaaaaaattaatcatcgccatcgtgattgtaatcatcgctgttggttcaggcgtattcttttatgcatctaaagataa
gaaaataaacgaaacaattgatgccattgaagataaaaacgttaagcaagtctttaaaaatagtacttaccaatctaaaa
acgataatggtgaagtagaaatgacagaccgccctattaagatttatgacagtctcggcgtcaaagatatcaacattaaa
gatcgtgatatcaaaaaggtttcgaaaaacaaaaaacaagtcacagcaaagtatgaacttcaaacgaattacggcaaaat
taatcgtgacgttaaattaaactttattaaagaagataaagattggaaattggattggaatcaaaatgccattattccag
gcatgaagaaaaatcaatccatcaatattgaaccattgaaatcagaacgaggtaagattttagacaggaacaatgtagag
ttagccactacaggaacaacacatgaagttggtattgttcctaataatgtttccacaagtgattacaaagcaatcgctga
aaagttagacctttcagaatcgtatattaaacagcaaacagaacaggattgggttaaagatgatacattcgtccctctca
agactgttcaagatatgaatcaagatttaaagaattttgttgaaaagtatcatctcacatcacaggaaacagaaagtcga
cagtatccgcttgaagaagcaacaacgcacttacttggatatgttggccctattaattcagaagaattgaagcaaaaagc
atttaaaggttataaaaaggatgccatcgttggtaaaaaaggtatcgaaaaactatacgataaagaccttcaaaataaag
acggataccgtgtcacaataattgatgataataataaagttattgatacattaatagagaaaaagaaaatagacggcaaa
gatattaaattaaccattgatgctagagtccaaaaaagtatttataacaacatgaaagatgactacggttcggggactgc
tattcatccacaaactggtgaactcttagcacttgtcagcacgccatcttatgatgtttatccatttatgaatggaatga
gcgatgaagattataagaaattaactgaagatgataaagagccactccttaataagttccaaattacgacatcaccaggt
tcgactcaaaaaatattaacagccatgattggcttaaacaataagacattagacggcaaaacaagttataaaattaatgg
aaaaggttggcaaaaagataaatcttggggtgactacaacgttacaagatacgaagttgtgaatgccgatatcgacttaa
aacaagctattgaatcatcagataatatcttctttgcgagagttgcacttgaattaggcagcaaaaaattcgaagaagga
atgaaacgccttggtgttggtgaagatatcccgagtgattatccattctacaatgcacaaatttcaaataagaacttaga
taatgaaatattgttagctgactcaggttatggccaaggtgaaatattaatcaatcctgttcaaattctttcaatataca
gcgcattagagaacaaaggtaatgtgaatgcaccacatgtactcaaagatacgaaaaataaagtctggaagaagaacatc
atttcccaggaaaatattaaattgttaacagacggtatgcaacaagtcgtgaacaaaacacatagagaagatatttatag
atcatatgccaacttagttggtaaatcaggtacagctgaactcaagatgaaacaaggtgagacaggacaacaaataggtt
ggttcatttcatatgataaagataatccaaatataatgatggctattaatgtgaaagatgtacaagataaaggcatggca
agttacaatgccaaaatatctggaaaagtgtatgacgatttatatgataacggtaagaaaacgtatcgtattgataaata
a

>>MEG_3769|Drugs|betalactams|Penicillin_binding_protein|MECA
atgaaaaagataaaaattgttccactcattttaatagttgcagctgccggcgttggtacatatttttatgcttcaaaaga
taaaaaaattaatgaaactgttgatgcaattgaagataaaaatttcaaacaagtttataaagatagcacttatcgttcta
aaaatgataacggcgaagtagaaatgactgaccgcccgataaaaatttatgaaagtttaggcgttaaagatataaatatt
caggatcgtaaaataaagaaagtatctaaaaataaaaagcaagttgatgctcaatataaactcaaaacaaactacggtac
catcgaccgcaatgttcgatttaatttcgttaaagaagatggtaaatggaaattagattggaatcaaagcgtcattattc
cagacatgcagaaagatcaaagcattcatatcgaaccagttaagtcggaacgcggtaaaattttagacagaaacaacgta
gaattggccaatacaggaacagcacatgagataggcattgttccaacgagtgtgtctaaagaagactataaagcaatcgc
tcaaaaactaagtatttcagaaggtcatattaaccaacaaatgaaccaagattgggttcaagatgatacattcgttccac
ttaagaccgttaaaacaatggataaagatttaagtgatttcgtaaaaaaacatcatcttacaactaatgaaacagaaagt
cgcaactatcctctagaaaaagcgacgtcacatttattaggttatgttggcccaattaactctgaagaattaaagaagaa
agaatttaaaggttatgaagatgatgctgtcgttggtaaaaaaggactcgaaaaactttatgataaaaagctccaacata
aagatggctatcgtgtcactatcatggacgataatagcaataaagtcgcacatacattagtagagaaaaagaaaaaagat
ggcaaagatattcaactgactattgatgctaacgttcaaaaaagcatttataacaacatgaaaaatgattatggctcagg
tactgctattcacccacaaacaggagaattgttagcacttgtaagcacgccttcatacgacgtatatccatttatgaatg
gtatgagcgacgaagcatataaaaaattaaccgaagataaaaaagaaccactgctcaacaagttccagatcacaacttca
ccaggctcaactcaaaaaatattaacagcaatgattggattaaataacaaaacattagacgatcaaacaaattataagat
taatggtaaaggctggcaaaaagataaatcttggggtgattataacgttacaagatatgaagtggtaaatggtaatatcg
acttaaaacaagcaatagaatcatcagataacattttctttgctagagtagcactcgaattaggaagtaagcaatttgaa
aaaggcatgaaaaaactaggtgttggtgaagacataccaagtgattacccattctataatgcacaaatttcaaacaaaga
tttagataatgaaatattgttagcagattcaggttacggacaaggtgaaatactgattaacccagtacaaatcctttcaa
tctatagcgcattagaaaataacggcaatattagcgcaccacacgtattaaaagacacgaaaaacaaagtttggaagaaa
aatattatttccgaggaaaatatcaatctattaacagacggcatgcaacaagtcgtaaacaaaacacatagagaagatat
ttatagaccatacgcaaacttagttggtaaatccggaacagcagaactcaaaatgaaacaaggcgaaacaggcagacaga
ttggttggtttatatcttatgataaagacaatccaaatatgatgatggccattaatgttaaagatgtacaagataaaggc
atggcgagttacaacgccaaaatctcaggtaaagtttatgatgacctatacgagaacggtaataaaaaatacgatataga
tgaataa

>>MEG_3770|Drugs|betalactams|Penicillin_binding_protein|MECA
atgaaaaagataaaaattgttccacttattttaatagttgtagttgtcgggtttggtatatatttttatgcttcaaaaga
taaagaaattaataatactattgatgcaattgaagataaaaatttcaaacaagtttataaagatagcagttatatttcta
aaagcgataatggtgaagtagaaatgactgaacgtccgataaaaatatataaaagtttaggcgttaaagatataaacatt
caggatcgtaaaataaaaaaagtatctaaaaataaaaaacgagtagatgctcaatataaaattaaaacaaactacggtaa
cattgatcgcaacgttcaatttaattttgttaaagaagatggtatgtggaagttagattggaatcatagcgtcattattc
caggaatgcagaaagaccaaagcatacatattgaaaatttaaaatcagaacgtggtaaaattttagaccgaaacaatgtg
gaattggccaatacaggaacagcatatgagataggcatcgttccaaagaatgtatctaaaaaagattataaagcaatcgc
taaagaactaagtatttctgaagactatatcaaacaacaaatggatcaaaattgggtacaagatgataccttcgttccac
ttaaaaccgttaaaaaaatggatgaagatttaagtgatttcgcaaaaaaatttcatcttacaactaatgaaacagaaagt
cgtaactatcctctagaaaaagcgacttcacatctattaggttatgttggtcccattaactctgaagaattaaaacaaaa
agaatataaaggctataaagatgatgcagttattggtaaaaagggactcgaaaaactttacgataaaaagctccaacatg
aagatggctatcgtgtcacaatcgttgacgataatagcaatacaatcgcacatacattaatagagaaaaagaaaaaagat
ggcaaagatattcaactaactattgatgctaaagttcaaaagagtatttataacaacatgaaaaatgattatggctcagg
tactgctatccaccctcaaacaggtgaattattagcacttgtaagcacaccttcatatgacgtctatccatttatgtatg
gcatgagtaacgaagaatataataaattaaccgaagataaaaaagaacctctgctcaacaagttccagattacaacttca
ccaggttcaactcaaaaaatattaacagcaatgattgggttaaataacaaaacattagacgataaaacaagttataaaat
cgatggtaaaggttggcaaaaagataaatcttggggtggttacaacgttacaagatatgaagtggtaaatggtaatatcg
acttaaaacaagcaatagaatcatcagataacattttctttgctagagtagcactcgaattaggcagtaagaaatttgaa
aaaggcatgaaaaaactaggtgttggtgaagatataccaagtgattatccattttataatgctcaaatttcaaacaaaaa
tttagataatgaaatattattagctgattcaggttacggacaaggtgaaatactgattaacccagtacagatcctttcaa
tctatagcgcattagaaaataatggcaatattaacgcacctcacttattaaaagacacgaaaaacaaagtttggaagaaa
aatattatttccaaagaaaatataaatctattaactgatggtatgcaacaagtcgtaaataaaacacataaagaagatat
ttatagatcttatgcaaacttaattggcaaatccggtactgcagaactcaaaatgaaacaaggagaaactggcagacaaa
ttgggtggtttatatcatatgataaagataatccaaacatgatgatggctattaatgttaaagatgtacaagataaagga
atggctagctacaatgccaaaatctcaggtaaagtgtatgatgagctatatgagaacggtaataaaaaatacgatataga
tgaataa

>>MEG_3771|Drugs|betalactams|Penicillin_binding_protein|MECA
atgaaaaagataaaaattgttccacttattttaatagttgtagttgtcgggtttggtatatatttttatgcttcaaaaga
taaagaaattaataatactattgatgcaattgaagataaaaatttcaaacaagtttataaagatagcagttatatttcta
aaagcgataatggtgaagtagaaatgactgaacgtccgataaaaatatataatagtttaggcgttaaagatataaacatt
caggatcgtaaaataaaaaaagtatctaaaaataaaaaacgagtagatgctcaatataaaattaaaacaaactacggtaa
cattgatcgcaacgttcaatttaattttgttaaagaagatggtatgtggaagttagattgggatcatagcgtcattattc
caggaatgcagaaagaccaaagcatacatattgaaaatttaaaatcagaacgtggtaaaattttagaccgaaacaatgtg
gaattggccaatacaggaacacatatgagattaggcatcgttccaaagaatgtatctaaaaaagattataaagcaatcgc
taaagaactaagtatttctgaagactatatcaacaacaaatggatcaaaattgggtacaagatgataccttcgttccact
ttaaaaccgttaaaaaaatggatgaatatttaagtgatttcgcaaaaaaatttcatcttacaactaatgaaacagaaagt
cgtaactatcctctagaaaaagcgacttcacatctattaggttatgttggtcccattaactctgaagaattaaaacaaaa
agaatataaaggctataaagatgatgcagttattggtaaaaagggactcgaaaaactttacgataaaaagctccaacatg
aagatggctatcgtgtcacaatcgttgacgataatagcaatacaatcgcacatacattaatagagaaaaagaaaaaagat
ggcaaagatattcaactaactattgatgctaaagttcaaaagagtatttataacaacatgaaaaatgattatggctcagg
tactgctatccaccctcaaacaggtgaattattagcacttgtaagcacaccttcatatgacgtctatccatttatgtatg
gcatgagtaacgaagaatataataaattaaccgaagataaaaaagaacctctgctcaacaagttccagattacaacttca
ccaggttcaactcaaaaaatattaacagcaatgattgggttaaataacaaaacattagacgataaaacaagttataaaat
cgatggtaaaggttggcaaaaagataaatcttggggtggttacaacgttacaagatatgaagtggtaaatggtaatatcg
acttaaaacaagcaatagaatcatcagataacattttctttgctagagtagcactcgaattaggcagtaagaaatttgaa
aaaggcatgaaaaaactaggtgttggtgaagatataccaagtgattatccattttataatgctcaaatttcaaacaaaaa
tttagataatgaaatattattagctgattcaggttacggacaaggtgaaatactgattaacccagtacagatcctttcaa
tctatagcgcattagaaaataatggcaatattaacgcacctcacttattaaaagacacgaaaaacaaagtttggaagaaa
aatattatttccaaagaaaatatcaatctattaaatgatggtatgcaacaagtcgtaaataaaacacataaagaagatat
ttatagatcttatgcaaacttaattggcaaatccggtactgcagaactcaaaatgaaacaaggagaaagtggcagacaaa
ttgggtggtttatatcatatgataaagataatccaaacatgatgatggctattaatgttaaagatgtacaagataaagga
atggctagctacaatgccaaaatctcaggtaaagtgtatgatgagctatatgagaacggtaataaaaaatacgatataga
tgaataa

>>MEG_3772|Drugs|betalactams|Penicillin_binding_protein|MECA
atgaaaaagataaaaattgttccacttattttaatagttgtagttgtcgggtttggtatatatttttatgcttcaaaaga
taaagaaattaataatactattgatgcaattgaagataaaaatttcaaacaagtttataaagatagcagttatatttcta
aaagcgataatggtgaagtagaaatgactgaacgtccgataaaaatatataatagtttaggcgttaaagatataaacatt
caggatcgtaaaataaaaaaagtatctaaaaataaaaaacgagtagatgctcaatataaaattaaaacaaactacggtaa
cattgatcgcaacgttcaatttaattttgttaaagaagatggtatgtggaagttagattgggatcatagcgtcattattc
caggaatgcagaaagaccaaagcatacatattgaaaatttaaaatcagaacgtggtaaaattttagaccgaaacaatgtg
gaattggccaatacaggaacagcatatgagataggcatcgttccaaagaatgtatctaaaaaagattataaagcaatcgc
taaagaactaagtatttctgaagactatatcaaacaacaaatggatcaaaattgggtacaagatgataccttcgttccac
ttaaaaccgttaaaaaaatggatgaatatttaagagatttcgcaaaaaaatttcatcttacaactaatgaaacagaaagt
cgtaactatcctctaggaaaagcgacttcacatctattaggttatgttggtcccattaactctgaagaattaaaacaaaa
agaatataaaggctataaagatgatgcagttattggtaaaaagggactcgaaaaactttacgataaaaagctccaacatg
aagatggctatcgtgtcacaatcgttgacgataatagcaatacaatcgcacatacattaatagagaaaaagaaaaaagat
ggcaaagatattcaactaactattgatgctaaagttcaaaagagtatttataacaacatgaaaaatgattatggctcagg
tactgctatccaccctcaaacaggtgaattattagcacttgtaagcacaccttcatatgacgtctatccatttatgtatg
gcatgagtaacgaagaatataataaattaaccgaagataaaaaagaacctctgctcaacaagttccagattacaacttca
ccaggttcaactcaaaaaatattaacagcaatgattgggttaaataacaaaacattagacgataaaacaagttataaaat
cgatggtaaaggttggcaaaaagataaatcttggggtggttacaacgttacaagatatgaagtggtaaatggtaatatcg
acttaaaacaagcaatagaatcatcagataacattttctttgctagagtagcactcgaattaggcagtaagaaatttgaa
aaaggcatgaaaaaactaggtgttggtgaagatataccaagtgattatccattttataatgctcaaatttcaaacaaaaa
tttagataatgaaatattattagctgattcaggttacggacaaggtgaaatactgattaacccagtacagatcctttcaa
tctatagcgcattagaaaataatggcaatattaacgcacctcacttattaaaagacacgaaaaacaaagtttggaagaaa
aatattatttccaaagaaaatatcaatctattaactgatggtatgcaacaagtcgtaaataaaacacataaagaagatat
ttatagatcttatgcaaacttaattggcaaatccggtactgcagaactcaaaatgaaacaaggagaaactggcagacaaa
ttgggtggtttatatcatatgataaagataatccaaacatgatgatggctattaatgttaaagatgtacaagataaagga
atggctagctacaatgccaaaatctcaggtaaagtgtatgatgagctatatgagaacggtaataaaaaatacgatataga
tgaataa

>>MEG_3773|Drugs|betalactams|Penicillin_binding_protein|MECA
atgaaaaagataaaaattgttccacttattttaatagttgtagttgtcgggtttggtatatatttttatgcttcaaaaga
taaagaaattaataatactattgatgcaattgaagataaaaatttcaaacaagtttataaagatagcagttatatttcta
aaagcgataatggtgaagtagaaatgactgaacgtccgataaaaatatataatagtttaggcgttaaagatataaacatt
caggatcgtaaaataaaaaaagtatctaaaaataaaaaacgagtagatgctcaatataaaattaaaacaaactacggtaa
cattgatcgcaacgttcaatttaattttgttaaagaagatggtatgtggaagttagattgggatcatagcgtcattattc
caggaatgcagaaagaccaaagcatacatattgaaaatttaaaatcagaacgtggtaaaattttagaccgaaacaatgtg
gaattggccaatacaggaacagcatatgagataggcatcgttccaaagaatgtatctaaaaaagattataaagcaatcgc
taaagaactaagtatttctgaagactatatcaaacaacaaatggatcaaaattgggtacaagatgataccttcgttccac
ttaaaaccgttaaaaaaatggatgaatatttaagtgatttcgcaaaaaaatttcatcttacaactaatgaaacagaaagt
cgtaactatcctctaggaaaagcgacttcacatctattaggttatgttggtcccattaactctgaagaattaaaacaaaa
agaatataaaggctataaagatgatgcagttattggtaaaaagggactcgaaaaactttacgataaaaagctccaacatg
aagatggctatcgtgtcacaatcgttgacgataatagcaatacaatcgcacatacattaatagagaaaaagaaaaaagat
ggcaaagatattcaactaactattgatgctaaagttcaaaagagtatttataacaacatgaaaaatgattatggctcagg
tactgctatccaccctcaaacaggtgaattattagcacttgtaagcacaccttcatatgacgtctatccatttatgtatg
gcatgagtaacgaagaatataataaattaaccgaagataaaaaagaacctctgctcaacaagttccagattacaacttca
ccaggttcaactcaaaaaatattaacagcaatgattgggttaaataacaaaacattagacgataaaacaagttataaaat
cgatggtaaaggttggcaaaaagataaatcttggggtggttacaacgttacaagatatgaagtggtaaatggtaatatcg
acttaaaacaagcaatagaatcatcagataacattttctttgctagagtagcactcgaattaggcagtaagaaatttgaa
aaaggcataaaaaaactaggtgttggtgaagatataccaagtgattatccattttataatgctcaaatttcaaacaaaaa
tttagataatgaaatattattagctgattcaggttacggacaaggtgaaatactgattaacccagtacagatcctttcaa
tctatagcgcattagaaaataatggcaatattaacgcacctcacttattaaaagacacgaaaaacaaagtttggaagaaa
aatattatttccaaagaaaatatcaatctattaactgatggtatgcaacaagtcgtaaataaaacacataaagaagatat
ttatagatcttatgcaaacttaattggcaaatccggtactgcagaactcaaaatgaaacaaggagaaactggcagacaaa
ttgggtggtttatatcatatgataaagataatccaaacatgatgatggctattaatgttaaagatgtacaagataaagga
atggctagctacaatgccaaaatctcaggtaaagtgtatgatgagctatatgagaacggtaataaaaaatacgatataga
tgaataa

>>MEG_3774|Drugs|betalactams|Penicillin_binding_protein|MECA
atgaaaaagataaaaattgttccacttattttaatagttgtagttgtcgggtttggtatatatttttatgcttccaaaga
taaagaaattaataatactattgatgcaattgaagataaaaatttcaaacaagtttataaagatagcagttatatttcta
aaagcgataatggtgaagtagaaatgactgaacgtccgataaaaatatataatagtttaggcgttaaagatataaacatt
caggatcgtaaaataaaaaaagtatctaaaaataaaaaacgagtagatgctcaatataaaattaaaacaaactacggtaa
cattgatcgcaacgttcaatttaattttgttaaagaagatggtatgtggaagttagattgggatcatagcgtcattattc
caggaatgcagaaagaccaaagcatacatattgaaaatttaaaatcagaacgtggtaaaattttagaccgaaacaatgtg
gaattggccaatacaggaacagcatatgagataggcatcgttccaaagaatgtatctaaaaaagattataaagcaatcgc
taaagaactaagtatttctgaagactatatcaaacaacaaatggatcaaaattgggtacaagatgataccttcgttccac
ttaaaaccgttaaaaaaatggatgaatatttaagtgatttcgcaaaaaaatttcatcttacaactaatgaaacaaaaagt
cgtaactatcctctaggaaaagcgacttcacatctattaggttatgttggtcccattaactctgaagaattaaaacaaaa
agaatataaaggctataaagatgatgcagttattggtaaaaagggactcgaaaaactttacgataaaaagctccaacatg
aagatggctatcgtgtcacaatcgttgacgataatagcaatacaatcgcacatacattaatagagaaaaagaaaaaagat
ggcaaagatattcaactaactattgatgctaaagttcaaaagagtatttataacaacatgaaaaatgattatggctcagg
tactgctatccaccctcaaacaggtgaattattagcacttgtaagcacaccttcatatgacgtctatccatttatgtatg
gcatgagtaacgaagaatataataaattaaccgaagataaaaaagaacctctgctcaacaagttccagattacaacttca
ccaggttcaactcaaaaaatattaacagcaatgattgggttaaataacaaaacattagacgataaaacaagttataaaat
cgatggtaaaggttggcaaaaagataaatcttggggtggttacaacgttacaagaaataaagtggtaaatggtaatatcg
acttaaaacaagcaatagaatcatcagataacattttctttgctagagtagcactcgaattaggcagtaagaaatttgaa
aaaggcatgaaaaaactaggtgttggtgaagatataccaagtgattatccattttataatgctcaaatttcaaacaaaaa
tttagataatgaaatattattagctgattcaggttacggacaaggtgaaatactgattaacccagtacagatcctttcaa
tctatagcgcattagaaaataatggcaatattaacgcacctcacttattaaaagacacgaaaaacaaagtttggaagaaa
aatattatttccaaagaaaatatcaatctattaactgatggtatgcaacaagtcgtaaataaaacacataaagaagatat
ttatagatcttatgcaaacttaattggcaaatccggtactgcagaactcaaaatgaaacaaggagaaactggcagacaaa
ttgggtggtttatatcatatgataaagataatccaaacatgatgatggctattaatgttaaagatgtacaagataaagga
atggctagctacaatgccaaaatctcaggtaaagtgtatgatgagctatatgagaacggtaataaaaaatacgatataga
tgaataa

>>MEG_3775|Drugs|betalactams|Penicillin_binding_protein|MECA
atgaaaaagataaaaattgttccacttattttaatagttgtagttgtcgggtttggtatatatttttatgcttccaaaga
taaagaaattaataatactattgatgcaattgaagataaaaatttcaaacaagtttataaagatagcagttatatttcta
aaagcgataatggtgaagtagaaatgactgaacgtccgataaaaatatataatagtttaggcgttaaagatataaacatt
caggatcgtaaaataaaaaaagtatctaaaaataaaaaacgagtagatgctcaatataaaattaaaacaaactacggtaa
cattgatcgcaacgttcaatttaattttgttaaagaagatggtatgtggaagttagattgggatcatagcgtcattattc
caggaatgcagaaagaccaaagcatacatattgaaaatttaaaatcagaacgtggtaaaattttagaccgaaacaatgtg
gaattggccaatacaggaacagcatatgagataggcatcgttccaaagaatgtatctaaaaaagattataaagcaatcgc
taaagaactaagtatttctgaagactatatcaaacaacaaatggatcaaaattgggtacaagatgataccttcgttccac
ttaaaaccgttaaaaaaatggatgaatatttaagtgatttcgcaaaaaaatttcatcttacaactaatgaaacagaaagt
cgtaactatcctctaggaaaagcgacttcacatctattaggttatgttggtcccattaactctgaagaattaaaacaaaa
agaatataaaggctataaagatgatgcagttattggtaaaaagggactcgaaaaactttacgataaaaagctccaacatg
aagatggctatcgtgtcacaatcgttgacgataatagcaatacaatcgcacatacattaatagagaaaaagaaaaaagat
ggcaaagatattcaactaactattgatgctaaagttcaaaagagtatttataacaacatgaaaaatgattatggctcagg
tactgctatccaccctcaaacaggtgaattattagcacttgtaagcacaccttcatatgacgtctatccatttatgtatg
gcatgagtaacgaagaatataataaattaaccgaagataaaaaagaacctctgctcaacaagttccagattacaacttca
ccaggttcaactcaaaaaatattaacagcaatgattgggttaaataacaaaacattagacgataaaacaagttataaaat
cgatggtaaaggttggcaaaaagataaatcttggggtggttacaacgttacaagaaataaagtggtaaatggtaatatcg
acttaaaacaagcaatagaatcatcagataacattttctttgctagagtagcactcgaattaggcagtaagaaatttgaa
aaaggcatgaaaaaactaggtgttggtgaagatataccaagtgattatccattttataatgctcaaatttcaaacaaaaa
tttagataatgaaatattattagctgattcaggttacggacaaggtgaaatactgattaacccagtacagatcctttcaa
tctatagcgcattagaaaataatggcaatattaacgcacctcacttattaaaagacacgaaaaacaaagtttggaagaaa
aatattatttccaaagaaaatatcaatctattaactgatggtatgcaacaagtcgtaaataaaacacataaagaagatat
ttatagatcttatgcaaacttaattggcaaatccggtactgcagaactcaaaatgaaacaaggagaaactggcagacaaa
ttgggtggtttatatcatatgataaagataatccaaacatgatgatggctattaatgttaaagatgtacaagataaagga
atggctagctacaatgccaaaatctcaggtaaagtgtatgatgagctatatgagaacggtaataaaaaatacgatataga
tgaataa

>>MEG_3776|Drugs|betalactams|Penicillin_binding_protein|MECA
atgaaaaagataaaaattgttccacttattttaatagttgtagttgtcgggtttggtatatatttttatgcttccaaaga
taaagaaattaataatactattgatgcaattgaagataaaaatttcaaacaagtttataaagatagcagttatatttcta
aaagcgataatggtgaagtagaaatgactgaacgtccgataaaaatatataatagtttaggcgttaaagatataaacatt
caggatcgtaaaataaaaaaagtatctaaaaataaaaaacgagtagatgctcaatataaaattaaaacaaactacggtaa
cattgatcgcaacgttcaatttaattttgttaaagaagatggtatgtggaagttagattgggatcatagcgtcattattc
caggaatgcagaaagaccaaagcatacatattgaaaatttaaaatcagaacgtggtaaaattttagaccgaaacaatgtg
gaattggccaatacaggaacagcatatgagataggcatcgttccaaagaatgtatctaaaaaagattataaagcaatcgc
taaagaactaagtatttctgaagactatatcaaacaacaaatggatcaaaattgggtacaagatgataccttcgttccac
ttaaaaccgttaaaaaaatggatgaatatttaagtgatttcgcaaaaaaatttcatcttacaactaatgaaacagaaagt
cgtaactatcctctaggaaaagcgacttcacatctattaggttatgttggtcccattaactctgaagaattaaaacaaaa
agaatataaaggctataaagatgatgcagttattggtaaaaagggactcgaaaaactttacgataaaaagctccaacatg
aagatggctatcgtgtcacaatcgttgacgataatagcaatacaatcgcacatacattaatagagaaaaagaaaaaagat
ggcaaagatattcaactaactattgatgctaaagttcaaaagagtatttataacaacatgaaaaatgattatggctcagg
tactgctatccaccctcaaacaggtgaattattagcacttgtaagcacaccttcatatgacgtctatccatttatgtatg
gcatgagtaacgaagaatataataaattaaccgaagataaaaaagaacctctgctcaacaagttccagattacaacttca
ccaggttcaactcaaaaaatattaacagcaatgattgggttaaataacaaaacattagacgataaaacaagttataaaat
cgatggtaaaggttggcaaaaagataaatcttggggtggttacaacgttacaagaaatgaagtggtaaatggtaatatcg
acttaaaacaagcaatagaatcatcagataacattttctttgctagagtagcactcgaattaggcagtaagaaatttgaa
aaaggcatgaaaaaactaggtgttggtgaagatataccaagtgattatccattttataatgctcaaatttcaaacaaaaa
tttagataatgaaatattattagctgattcaggttacggacaaggtgaaatactgattaacccagtacagatcctttcaa
tctatagcgcattagaaaataatggcaatattaacgcacctcacttattaaaagacacgaaaaacaaagtttggaagaaa
aatattatttccaaagaaaatatcaatctattaactgatggtatgcaacaagtcgtaaataaaacacataaagaagatat
ttatagatcttatgcaaacttaattggcaaatccggtactgcagaactcaaaatgaaacaaggagaaactggcagacaaa
ttgggtggtttatatcatatgataaagataatccaaacatgatgatggctattaatgttaaagatgtacaagataaagga
atggctagctacaatgccaaaatctcaggtaaagtgtatgatgagctatatgagaacggtaataaaaaatacgatataga
tgaataa

>>MEG_3777|Drugs|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGA
TAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCTA
AAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAATAGTTTAGGCGTTAAAGATATAAACATT
CAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAA
CATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTC
CAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTG
GAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCAC
TTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAGAAAGT
CGTAACTATCCTCTAGGAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAA
AGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATG
AAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGAT
GGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGG
TACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATG
GCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCA
CCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAAT
CGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCG
ACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAA
AAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAA
TTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAA
TCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATAT
TTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACAAA
TTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAGGA
ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGA
TGAATAA

>>MEG_3778|Drugs|betalactams|Penicillin_binding_protein|MECA
GTGTTATCATCTTTTTTAATGTTAAGTATAATCAGTTCATTGCTCACGATATGTGTAATTTTTTTAGTGAGAATGCTCTA
TATAAAATATACTCAAAATATTATGTCACATAAGATTTGGTTATTAGTGCTCGTCTCCACGTTAATTCCATTAATACCAT
TTTACAAAATATCGAATTTTACATTTTCAAAAGATATGATGAATCGAAATGTATCTGACACGACTTCTTCGGTTAGTCAT
ATGTTAGATGGTCAACAATCATCTGTTACGAAAGACTTAGCAATTAATGTTAATCAGTTTGAGACCTCAAATATAACGTA
TATGATTCTTTTGATATGGGTATTTGGTAGTTTGTTGTGCTTATTTTATATGATTAAGGCATTCCGACAAATTGATGTTA
TTAAAAGTTCGTCATTGGAATCGTCATATCTTAATGAACGACTTAAAGTATGTCAAAGTAAGATGCAGTTCTACAAAAAG
CATATAACAATTAGTTATAGTTCAAACATTGATAATCCGATGGTATTTGGTTTAGTGAAATCCCAAATTGTACTACCAAC
TGTCGTAGTCGAAACCATGAATGACAAAGAAATTGAATATATTATTCTACATGAACTATCACATGTGAAAAGTCATGACT
TAATATTCAACCAGCTTTATGTTGTTTTTAAAATGATATTCTGGTTTAATCCTGCACTATATATAAGTAAAACAATGATG
GACAATGACTGTGAAAAAGTATGTGATAGAAACGTTTTAAAAATTTTGAATCGCCATGAACATATACGTTATGGTGAATC
GATATTAAAATGCTCTATTTTAAAATCTCAGCACATAAATAATGTGGCAGCACAATATTTACTAGGTTTTAATTCAAATA
TTAAAGAACGTGTTAAGTATATTGCACTTTATGATTCAATGCCTAAACCTAATCGAAACAAGCGTATTGTTGCGTATATT
GTATGTAGTATATCGCTTTTAATACAAGCACCGTTACTATCTGCACATGTTCAACAAGACAAATATGAAACAAATGTATC
ATATAAAAAATTAAATCAACTAGCTCCGTATTTCAAAGGATTTGATGGAAGTTTTGTGCTTTATAATGAACGGGAGCAAG
CTTATTCTATTTATAATGAACCAGAAAGTAAACAACGATATTCACCTAATTCTACTTACAAAATTTATTTAGCGTTAATG
GCATTCGACCAAAATTTACTCTCATTAAATCATACTGAACAACAATGGGATAAACATCAATATCCATTTAAAGAATGGAA
CCAAGATCAAAATTTAAATTCTTCAATGAAATATTCAGTAAATTGGTATTACGAAAATTTAAACAAACATTTAAGACAAG
ATGAGGTTAAATCTTATTTAGATCTAATTGAATATGGTAATGAAGAAATATCAGGGAATGAAAATTATTGGAATGAATCT
TCATTAAAAATTTCTGCAATAGAACAGGTTAATTTGTTGAAAAATATGAAACAACATAACATGCATTTTGATAATAAGGC
TATTGAAAAAGTTGAAAATAGTATGACTTTGAAACAAAAAGATACTTATAAATATGTAGGTAAAACTGGAACAGGAATCG
TGAATCACAAAGAAGCAAATGGATGGTTCGTAGGTTATGTTGAAACGAAAGATAATACGTATTATTTTGCTACACATTTA
AAAGGCGAAGACAATGCGAATGGCGAAAAAGCACAACAAATTTCTGAGCGTATTTTAAAAGAAATGGAATTAATATAA

>>MEG_3779|Drugs|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGA
TAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCTA
AAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAATAGTTTAGGCGTTAAAGATATAAACATT
CAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAA
CATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTC
CAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTG
GAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCAC
TTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAAAAAGT
CGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAA
AGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATG
AAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGAT
GGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGG
TACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATG
GCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCA
CCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAAT
CGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCG
ACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAA
AAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAA
TTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAA
TCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATAT
TTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACAAA
TTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAGGA
ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGA
TGAATAA

>>MEG_3780|Drugs|betalactams|Penicillin_binding_protein|MECA
TTATTCATCTATATCGTATTTTTTATTACCGTTCTCATATAGCTCATCATACACTTTACCTGAGATTTTGGCATTGTAGC
TAGCCATTCCTTTATCTTGTACATCTTTAACATTAATAGCCATCATCATGTTTGGATTATCTTTATCATATGATATAAAC
CACCCAATTTGTCTGCCAGTTTCTCCTTGTTTCATTTTGAGTTCTGCAGTACCGGATTTGCCAATTAAGTTTGCATAAGA
TCTATAAATATCTTCTTTATGTGTTTTATTTACGACTTGTTGCATACCATCAGTTAATAGATTGATATTTTCTTTGGAAA
TAATATTTTTCTTCCAAACTTTGTTTTTCGTGTCTTTTAATAAGTGAGGTGCGTTAATATTGCCATTATTTTCTAATGCG
CTATAGATTGAAAGGATCTGTACTGGGTTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGCTAATAATATTTCATT
ATCTAAATTTTTGTTTGAAATTTGAGCATTATAAAATGGATAATCACTTGGTATATCTTCACCAACACCTAGTTTTTTCA
TGCCTTTTTCAAATTTCTTACTGCCTAATTCGAGTGCTACTCTAGCAAAGAAAATGTTATCTGATGATTCTATTGCTTGT
TTTAAGTCGATATTACCATTTACCACTTCATATCTTGTAACGTTGTAACCACCCCAAGATTTATCTTTTTGCCAACCTTT
ACCATCGATTTTATAACTTGTTTTATCGTCTAATGTTTTGTTATTTAACCCAATCATTGCTGTTAATATTTTTTGAGTTG
AACCTGGTGAAGTTGTAATCTGGAACTTGTTGAGCAGAGGTTCTTTTTTATCTTCGGTTAATTTATTATATTCTTCGTTA
CTCATGCCATACATAAATGGATAGACGTCATATGAAGGTGTGCTTACAAGTGCTAATAATTCACCTGTTTGAGGGTGGAT
AGCAGTACCTGAGCCATAATCATTTTTCATGTTGTTATAAATACTCTTTTGAACTTTAGCATCAATAGTTAGTTGAATAT
CTTTGCCATCTTTTTTCTTTTTCTCTATTAATGTATGTGCGATTGTATTGCTATTATCGTCAACGATTGTGACACGATAG
CCATCTTCATGTTGGAGCTTTTTATCGTAAAGTTTTTCGAGTCCCTTTTTACCAATAACTGCATCATCTTTATAGCCTTT
ATATTCTTTTTGTTTTAATTCTTCAGAGTTAATGGGACCAACATAACCTAATAGATGTGAAGTCGCTTTTCCTAGAGGAT
AGTTACGACTTTCTGTTTCATTAGTTGTAAGATGAAATTTTTTTGCGAAATCACTTAAATATTCATCCATTTTTTTAACG
GTTTTAAGTGGAACGAAGGTATCATCTTGTACCCAATTTTGATCCATTTGTTGTTTGATATAGTCTTCAGAAATACTTAG
TTCTTTAGCGATTGCTTTATAATCTTTTTTAGATACATTCTTTGGAACGATGCCTATCTCATATGCTGTTCCTGTATTGG
CCAATTCCACATTGTTTCGGTCTAAAATTTTACCACGTTCTGATTTTAAATTTTCAATATGTATGCTTTGGTCTTTCTGC
ATTCCTGGAATAATGACGCTATGATCCCAATCTAACTTCCACATACCATCTTCTTTAACAAAATTAAATTGAACGTTGCG
ATCAATGTTACCGTAGTTTGTTTTAATTTTATATTGAGCATCTACTCGTTTTTTATTTTTAGATACTTTTTTTATTTTAC
GATCCTGAATGTTTATATCTTTAACGCCTAAACTATTATATATTTTTATCGGACGTTCAGTCATTTCTACTTCACCATTA
TCGCTTTTAGAAATATAACTGCTATCTTTATAAACTTGTTTGAAATTTTTATCTTCAATTGCATCAATAGTATTATTAAT
TTCTTTATCTTTGGAAGCATAAAAATATATACCAAACCCGACAACTACAACTATTAAAATAAGTGGAACAATTTTTATCT
TTTTCAT

>>MEG_3781|Drugs|betalactams|Penicillin_binding_protein|MECA
ATCGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATAT
CGACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTG
AAAAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAA
AATTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTC
AATCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGA
AAAATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCCACAAGTCGTAAATAAAACACATAAAGAAGAT
ATTTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACA
AATTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAG
GAATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATA
GATGAATAA

>>MEG_3782|Drugs|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGA
TAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCTA
AAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAATAGTTTAGGCGTTAAAGATATAAACATT
CAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAA
CATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTC
CAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTG
GAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCAC
TTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAGAAAGT
CGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAA
AGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATG
AAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGAT
GGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGG
TACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATG
GCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCA
CCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAAT
CGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCG
ACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAA
AAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAA
TTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAA
TCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATAT
TTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACAAA
TTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAGGA
ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGA
TGAATAA

>>MEG_3783|Drugs|betalactams|Penicillin_binding_protein|MECA
TTATTCATCTATATCGTATTTTTTATTACCGTTCTCATATAGCTCATCATACACTTTACCTGAGATTTTGGCATTGTAGC
TAGCCATTCCTTTATCTTGTACATCTTTAACATTAATAGCCATCATCATGTTTGGATTATCTTTATCATATGATATAAAC
CACCCAATTTGTCTGCCAGTTTCTCCTTGTTTCATTTTGAGTTCTGCAGTACCGGATTTGCCAATTAAGTTTGCATAAGA
TCTATAAATATCTTCTTTATGTGTTTTATTTACGACTTGTTGCATACCATCAGTTAATAGATTGATATTTTCTTTGGAAA
TAATATTTTTCTTCCAAACTTTGTTTTTCGTGTCTTTTAATAAGTGAGGTGCGTTAATATTGCCATTATTTTCTAATGCG
CTATAGATTGAAAGGATCTGTACTGGGTTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGCTAATAATATTTCATT
ATCTAAATTTTTGTTTGAAATTTGAGCATTATAAAATGGATAATCACTTGGTATATCTTCACCAACACCTAGTTTTTTCA
TGCCTTTTTCAAATTTCTTACTGCCTAATTCGAGTGCTACTCTAGCAAAGAAAATGTTATCTGATGATTCTATTGCTTGT
TTTAAGTCGATATTACCATTTACCACTTCATATCTTGTAACGTTGTAACCACCCCAAGATTTATCTTTTTGCCAACCTTT
ACCATCGATTTTATAACTTGTTTTATCGTCTAATGTTTTGTTATTTAACCCAATCATTGCTGTTAATATTTTTTGAGTTG
AACCTGGTGAAGTTGTAATCTGGAACTTGTTGAGCAGAGGTTCTTTTTTATCTTCGGTTAATTTATTATATTCTTCGTTA
CTCATGCCATACATAAATGGATAGACGTCATATGAAGGTGTGCTTACAAGTGCTAATAATTCACCTGTTTGAGGGTGGAT
AGCAGTACCTGAGCCATAATCATTTTTCATGTTGTTATAAATACTCTTTTGAACTTTAGCATCAATAGTTAGTTGAATAT
CTTTGCCATCTTTTTTCTTTTTCTCTATTAATGTATGTGCGATTGTATTGCTATTATCGTCAACGATTGTGACACGATAG
CCATCTTCATGTTGGAGCTTTTTATCGTAAAGTTTTTCGAGTCCCTTTTTACCAATAACTGCATCATCTTTATAGCCTTT
ATATTCTTTTTGTTTTAATTCTTCAGAGTTAATGGGACCAACATAACCTAATAGATGTGAAGTCGCTTTTCCTAGAGGAT
AGTTACGACTTTCTGTTTCATTAGTTGTAAGATGAAATTTTTTTGCGAAATCTCTTAAATATTCATCCATTTTTTTAACG
GTTTTAAGTGGAACGAAGGTATCATCTTGTACCCAATTTTGATCCATTTGTTGTTTGATATAGTCTTCAGAAATACTTAG
TTCTTTAGCGATTGCTTTATAATCTTTTTTAGATACATTCTTTGGAACGATGCCTATCTCATATGCTGTTCCTGTATTGG
CCAATTCCACATTGTTTCGGTCTAAAATTTTACCACGTTCTGATTTTAAATTTTCAATATGTATGCTTTGGTCTTTCTGC
ATTCCTGGAATAATGACGCTATGATCCCAATCTAACTTCCACATACCATCTTCTTTAACAAAATTAAATTGAACGTTGCG
ATCAATGTTACCGTAGTTTGTTTTAATTTTATATTGAGCATCTACTCGTTTTTTATTTTTAGATACTTTTTTTATTTTAC
GATCCTGAATGTTTATATCTTTAACGCCTAAACTATTATATATTTTTATCGGACGTTCAGTCATTTCTACTTCACCATTA
TCGCTTTTAGAAATATAACTGCTATCTTTATAAACTTGTTTGAAATTTTTATCTTCAATTGCATCAATAGTATTATTAAT
TTCTTTATCTTTTGAAGCATAAAAATATATACCAAACCCGACAACTACAACTATTAAAATAAGTGGAACAATTTTTATCT
TTTTCATCAA

>>MEG_3784|Drugs|betalactams|Penicillin_binding_protein|MECA
TTGATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAA
AGATAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTT
CTAAAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAATAGTTTAGGCGTTAAAGATATAAAC
ATTCAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGG
TAACATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTA
TTCCAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAAT
GTGGAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAAT
CGCTAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTC
CACTTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAGAA
AGTCGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACA
AAAAGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAAC
ATGAAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAA
GATGGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTC
AGGTACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGT
ATGGCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACT
TCACCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAA
AATCGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATA
TCGACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTT
GAAAAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAA
AAATTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTT
CAATCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAG
AAAAATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGA
TATTTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACAGGCAGAC
AAATTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAA
GGAATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATAT
AGATGAATAA

>>MEG_3785|Drugs|betalactams|Penicillin_binding_protein|MECA
TTATTCATCTATATCGTATTTTTTATTACCGTTCTCATATAGCTCATCATACACTTTACCTGAGATTTTGGCATTGTAGC
TAGCCATTCCTTTATCTTGTACATCTTTAACATTAATAGCCATCATCATGTTTGGATTATCTTTATCATATGATATAAAC
CACCCAATTTGTCTGCCAGTTTCTCCTTGTTTCATTTTGAGTTCTGCAGTACCGGATTTGCCAATTAAGTTTGCATAAGA
TCTATAAATATCTTCTTTATGTGTTTTATTTACGACTTGTTGCATACCATCAGTTAATAGATTGATATTTTCTTTGGAAA
TAATATTTTTCTTCCAAACTTTGTTTTTCGTGTCTTTTAATAAGTGAGGTGCGTTAATATTGCCATTATTTTCTAATGCG
CTATAGATTGAAAGGATCTGTACTGGGTTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGCTAATAATATTTCATT
ATCTAAATTTTTGTTTGAAATTTGAGCATTATAAAATGGATAATCACTTGGTATATCTTCACCAACACCTAGTTTTTTCA
TGCCTTTTTCAAATTTCTTACTGCCTAATTCGAGTGCTACTCTAGCAAAGAAAATGTTATCTGATGATTCTATTGCTTGT
TTTAAGTCGATATTACCATTTACCACTTCATATCTTGTAACGTTGTAACCACCCCAAGATTTATCTTTTTGCCAACCTTT
ACCATCGATTTTATAACTTGTTTTATCGTCTAATGTTTTGTTATTTAACCCAATCATTGCTGTTAATATTTTTTGAGTTG
AACCTGGTGAAGTTGTAATCTGGAACTTGTTGAGCAGAGGTTCTTTTTTATCTTCGGTTAATTTATTATATTCTTCGTTA
CTCATGCCATACATAAATGGATAGACGTCATATGAAGGTGTGCTTACAAGTGCTAATAATTCACCTGTTTGAGGGTGGAT
AGCAGTACCTGAGCCATAATCATTTTTCATGTTGTTATAAATACTCTTTTGAACTTTAGCATCAATAGTTAGTTGAATAT
CTTTGCCATCTTTTTTCTTTTTCTCTATTAATGTATGTGCGATTGTATTGCTATTATCGTCAACGATTGTGACACGATAG
CCATCTTCATGTTGGAGCTTTTTATCGTAAAGTTTTTCGAGTCCCTTTTTACCAATAACTGCATCATCTTTATAGCCTTT
ATATTCTTTTTGTTTTAATTCTTCAGAGTTAATGGGACCAACATAACCTAATAGATGTGAAGTCGCTTTTCCTAGAGGAT
AGTTACGACTTTCTGTTTCATTAGTTGTAAGATGAAATTTTTTTGCGAAATCACTTAAATATTCATCCATTTTTTTAACG
GTTTTAAGTGGAACGAAGGTATCATCTTGTACCCAATTTTGATCCATTTGTTGTTTGATATAGTCTTCAGAAATACTTAG
TTCTTTAGCGATTGCTTTATAATCTTTTTTAGATACATTCTTTGGAACGATGCCTATCTCATATGCTGTTCCTGTATTGG
CCAATTCCACATTGTTTCGGTCTAAAATTTTACCACGTTCTGATTTTAAATTTTCAATATGTATGCTTTGGTCTTTCTGC
ATTCCTGGAATAATGACGCTATGATCCCAATCTAACTTCCACATACCATCTTCTTTAACAAAATTAAATTGAACGTTGCG
ATCAATGTTACCGTAGTTTGTTTTAATTTTATATTGAGCATCTACTCGTTTTTTATTTTTAGATACTTTTTTTATTTTAC
GATCCTGAATGTTTATATCTTTAACGCCTAAACTATTATATATTTTTATCGGACGTTCAGTCATTTCTACTTCACCATTA
TCGCTTTTAGAAATATAACTGCTATCTTTATAAACTTGTTTGAAATTTTTATCTTCAATTGCATCAATAGTATTATTAAT
TTCTTTATCTTTTGAAGCATAAAAATATATACCAAACCCGACAACTACAACTATTAAAATAAGTGGAACAATTTTTATCT
TTTTCATCAA

>>MEG_3786|Drugs|betalactams|Penicillin_binding_protein|MECA
GTGTTATCATCTTTTTTAATGTTAAGTATAATCAGTTCATTGCTCACGATATGTGTAATTTTTTTAGTGAGAATGCTCTA
TATAAAATATACTCAAAATATTATGTCACATAAGATTTGGTTATTAGTGCTCGTCTCCACGTTAATTCCATTAATACCAT
TTTACAAAATATCGAATTTTACATTTTCAAAAGATATGATGAATCGAAATGTATCTGACACGACTTCTTCGGTTAGTCAT
ATGTTAGATGGTCAACAATCATCTGTTACGAAAGACTTAGCAATTAATGTTAATCAGTTTGAGACCTCAAATATAACGTA
TATGATTCTTTTGATATGGGTATTTGGTAGTTTGTTGTGCTTATTTTATATGATTAAGGCATTCCGACAAATTGATGTTA
TTAAAAGTTCGTCATTGGAATCGTCATATCTTAATGAACGACTTAAAGTATGTCAAAGTAAGATGCAGTTCTACAAAAAG
CATATAACAATTAGTTATAGTTCAAACATTGATAATCCGATGGTATTTGGTTTAGTGAAATCCCAAATTGTACTACCAAC
TGTCGTAGTCGAAACCATGAATGACAAAGAAATTGAATATATTATTCTACATGAACTATCACATGTGAAAAGTCATGACT
TAATATTCAACCAGCTTTATGTTGTTTTTAAAATGATATTCTGGTTTAATCCTGCACTATATATAAGTAAAACAATGATG
GACAATGACTGTGAAAAAGTATGTGATAGAAACGTTTTAAAAATTTTGAATCGCCATGAACATATACGTTATGGTGAATC
GATATTAAAATGCTCTATTTTAAAATCTCAGCACATAAATAATGTGGCAGCACAATATTTACTAGGTTTTAATTCAAATA
TTAAAGAACGTGTTAAGTATATTGCACTTTATGATTCAATGCCTAAACCTAATCGAAACAAGCGTATTGTTGCGTATATT
GTATGTAGTATATCGCTTTTAATACAAGCACCGTTACTATCTGCACATGTTCAACAAGACAAATATGAAACAAATGTATC
ATATAAAAAATTAAATCAACTAGCTCCGTATTTCAAAGGATTTGATGGAAGTTTTGTGCTTTATAATGAACGGGAGCAAG
CTTATTCTATTTATAATGAACCAGAAAGTAAACAACGATATTCACCTAATTCTACTTACAAAATTTATTTAGCGTTAATG
GCATTCGACCAAAATTTACTCTCATTAAATCATACTGAACAACAATGGGATAAACATCAATATCCATTTAAAGAATGGAA
CCAAGATCAAAATTTAAATTCTTCAATGAAATATTCAGTAAATTGGTATTACGAAAATTTAAACAAACATTTAAGACAAG
ATGAGGTTAAATCTTATTTAGATCTAATTGAATATGGTAATGAAGAAATATCAGGGAATGAAAATTATTGGAATGAATCT
TCATTAAAAATTTCTGCAATAGAACAGGTTAATTTGTTGAAAAATATGAAACAACATAACATGCATTTTGATAATAAGGC
TATTGAAAAAGTTGAAAATAGTATGACTTTGAAACAAAAAGATACTTATAAATATGTAGGTAAAACTGGAACAGGAATCG
TGAATCACAAAGAAGCAAATGGATGGTTCGTAGGTTATGTTGAAACGAAAGATAATACGTATTATTTTGCTACACATTTA
AAAGGCGAAGACAATGCGAATGGCGAAAAAGCACAACAAATTTCTGAGCGTATTTTAAAAGAAATGGAGTTAATATAA

>>MEG_3787|Drugs|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGA
TAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCTA
AAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAATAGTTTAGGCGTTAAAGATATAAACATT
CAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAA
CATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTC
CAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTG
GAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCAC
TTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAGAAAGT
CGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAA
AGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATG
AAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGAT
GGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGG
TACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATG
GCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCA
CCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAAT
CGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCG
ACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAA
AAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAA
TTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAA
TCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATAT
TTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACAGGCAGACAAA
TTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAGGA
ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGA
TGAATAA

>>MEG_3788|Drugs|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGA
TAAAGAAATTAATAATACTATTGATGCAATTGGAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCTA
AAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAATAGTTTAGGCGTTAAAGATATAAACATT
CAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAA
CATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTC
CAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTG
GAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCCATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCAC
TTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAGAAAGT
CGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAA
AGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATG
AAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGAT
GGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGG
TACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATG
GCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCA
CCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAAT
CGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCG
ACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAA
AAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAA
TTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAA
TCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTTAATAAAACACATAAAGAAGATAT
TTATAGATCTTATGCCAACTTAATTGGCAAATCCGGTACTGCCGAACTCAAAATGAAACAAGGAGAAACTGGCCGACCAA
TTGGGTGGTTTATATCATATGATAAAGATAATCCCCACCTGATGATGGCTATTAATGTTAAAGATGTTCCAGATAAAGGA
ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGA
TGAATAA

>>MEG_3789|Drugs|betalactams|Penicillin_binding_protein|MECA
ATGAAGAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTGTATGCTTCAAAAGA
TAAAGAAATTAATAAAACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCTA
AAAGCGATAATGGCGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAAAAGTTTAGGCGTTAAAGATATAAACATT
CAGGACCGCAAAATAAAAAAAATATCTAAAAATAAAAAAAGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAA
CATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGCATGTGGAAATTAGATTGGGATCATAGCGTCATTATTC
CAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTG
GAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAGTGTATTTAAAAAAGATTATAAAGCAATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCAC
TTAAAACCGTTAAAAAAATGGATGAAGATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAACGAAACAGAAAGT
CGTAACTATCCTCTAGAAGAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAA
AGAATATAAAGGTTATAAAGATGATGCAGTTGTTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATG
AAGATGGCTATCGTGTCACAATCTTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGAT
GGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGG
TACTGCTATTCACCCTCAAACAGGTGAATTGTTAGCACTTGTAAGCACACCTTCATATGACGTGTACCCATTTATGTATG
GCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCACTGCTCAACAAGTTCCAGATTACAACTTCA
CCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAAT
CGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCG
ACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAGTTTGAA
AAAGCCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAA
TTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAA
TCTATAGCGCATTAGAAAACAATGGCAATATCAATGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATAT
TTATAGACCTTACGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGGAGACAAA
TTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAGGA
ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGA
TAAATAA

>>MEG_3790|Drugs|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAATTAATCATCGCCATCGTGATAGTAATCATCGCTGTTGGTTCAGGCGTATTCTTTTATGCATCTAAAGATAA
GAAAATAAACGAAACAATTGATGCCATTGAAGATAAAAACGTTAAGCAAGTCTTCAAAAATAGTACTTACCAATCTAAAA
ACGATAATGGTGAAGTAGAAATGACAGACCGTCCTATTAAGATTTATGACAGTCTCGGCGTCAAAGATATCAACATTAAA
GATCGTGATATCAAAAAGGTTTCAAAAGACAAAAAGCAAGTCACAGCAAAATATGAACTTCAAACGAATTACGGCAAAAT
TAATCGCGACGTTAAATTAAACTTTATTAAAGAAGATAAAGATTGGAAATTGGATTGGAATCAAAGTGTCATTATTCCAG
GCATGAAGAAAAATCAATCTATCAATATTGAACCATTGAAATCAGAACGAGGTAAGATTTTAGACCGAAACAATGTAGAG
TTAGCCACTACAGGAACAGCACATGAAGTTGGCATTGTTCCTAATAATGTTTCGTCAAATGATTATAAAGCAATCGCTGA
AAAATTAGACCTTTCAGAATCGTACATTAAACAACAAACAGAACAGGACTGGGTTAAAGATGATACATTCGTCCCTCTTA
AGACTGTTCAAAATATGAATCAAGATACAAAGAATTTTGTTGAGAAGTATCATCTCACAACACAAGAAACAGAAAGTCGA
CAGTATCCGCTTGAAGAAGCAACAACGCACTTGCTTGGTTATGTTGGCCCTATTAACTCAGAAGAATTAAAGCAAAAAGC
ATTTAAAGGTTATAAAAAAGATGCCATCGTCGGTAAAAAAGGGATCGAAAAACTTTACGATAAAGAACTTCAAAATAAAG
ACGGGTATCGTGTCACAATTATTGATGATAATAATAAAGTGATAGATACATTGATTAAGAAAAAGAAAAAAGATGGCAAA
GATATTAAATTAACCATTGATGCCAGAGTTCAAAAAAGTATTTATAACAACATGAAAGATGACTACGGTTCAGGGACTGC
TATTCATCCACAAACAGGCGAATTGTTAGCACTTGTCAGCACGCCATCTTATGATGTTTATCCATTTATGAACGGTATGA
GCGATGAAGATTATAAGAAATTAACAGAAGATGATAAAGAGCCACTTCTTAATAAGTTCCAAATCACGACATCACCAGGT
TCTACTCAAAAAATATTAACAGCTATGATTGGCTTAAATAATAAGACGTTAGACGACAAAACAAGTTATAAAATTAACGG
AAAAGGCTGGCAAAAAGATAAATCTTGGGGTGATTACAACGTCACAAGATATGAAGTTGTTAATGGTGATATCGACTTAA
AACAAGCTATTGAATCATCGGATAATATCTTCTTTGCGAGAGTTGCACTTGAATTAGGAAGTAAAAAATTCGAAGAAGGT
ATGAAACGTCTAGGTGTTGGTGAAGATATCCCGAGTGATTATCCATTCTATAATGCACAAATTTCAAATAAGAACTTAGA
TAATGAAATATTGTTAGCTGACTCAGGTTATGGCCAAGGTGAAATATTGATTAATCCAGTTCAAATTCTTTCAATATACA
GTGCATTAGAGAATAAAGGTAATGTGAATGCACCACATGTACTGAAAGATACGAAAAATAAAGTCTGGAAGAAGAATATC
ATTTCCCAGGAAAATATTAAATTGTTAACAGACGGTATGCAACAAGTCGTCAACAAAACACATAGAGAAGATATTTATAG
ATCATATGCCAACTTAGTTGGTAAATCAGGTACAGCTGAACTCAAGATGAAACAAGGTGAGACAGGACAACAAATAGGCT
GGTTCATTTCATATGATAAAGATAATCCAAATATGATGATGGCTATTAATGTGAAAGATGTTCAAGATAAAGGTATGGCA
AGTTACAATGCCAAAATATCAGGAAAAGTGTATGACGATTTATATGATAACGGCAAGAAAACGTATCGTATTGATAAATA
A

>>MEG_3791|Drugs|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAATTAATCATCGCCATCGTGATTGTAATCATCGCTGTTGGTTCAGGCGTATTCTTTTATGCATCTAAAGATAA
GAAAATAAACGAAACAATTGATGCCATTGAAGATAAAAACGTTAAGCAAGTCTTTAAAAATAGTACTTACCAATCTAAAA
ACGATAATGGTGAAGTAGAAATGACAGACCGCCCTATTAAGATTTATGACAGTCTCGGCGTCAAAGATATCAACATTAAA
GATCGTGATATCAAAAAGGTTTCGAAAAACAAAAAGCAAGTCACAGCAAAGTATGAACTGCAAACGAATTACGGCAAAAT
TAATCATGACGTTAAATTAAACTTTATTAAAGAAGATAAAGATTGGAAATTGGATTGGAATCAAAGTGTCATTATTCCAG
GCATGAAGAAAAATCAATCCATCAATATTGAACCATTGAAATCAGAACGTGGTAAGATTTTAGACCGAAACAATGTAGAG
TTAGCCACTACAGGAACAGCACATGAAGTTGGTATTGTTCCTAATAATGTTTCCACAAGTGATTACAAAGCAATCGCTGA
AAAGTTAGACCTTTCAGAATCGTATATTAAACAACAAACAGAACAGGATTGGGTTAAAGATGATACATTCGTCCCTCTCA
AGACTGTTCAAGATATGAATCAAGATTTAAAGAATTTTGTTGAAAAGTATCATCTCACATCACAGGAAACAGAAAGTCGA
GAGTATCCGTTTGAAGAAGCAACAACGCACTTACTTGGATACGTTGGCCCTATTAATTCAGAAGAATTGAAGCAAAAAGC
ATTTAAAGGTTATAAAAAGGATGCCATCGTTGGTAAAAAAGGTATCGAAAAACTATACGATAAAGAACTTCAAAATAAAG
ACGGATACCGTGTCACAATTATTGATGATCAAAATAAAGTGATAGATACATTAATCGAGAAAAAGAAAAAAGACGGTAAA
GATATTAAATTAACCATTGATGCTAGAGTCCAAAAAAGTATTTATAACAACATGAAAGATGACTACGGTTCGGGGACTGC
TATTCATCCAAAAACTGGTGAACTCTTAGCACTTGTCAGCACGCCATCTTATGATGTTTATCCATTTATGAATGGAATGA
ACGATGAAGATTATAAGAAATTAACTGAAGATGATAAAGAGCCACTCCTTAATAAGTTCCAAATTACGACATCACCGGGT
TCGACTCAAAAAATATTAACAGCCATGATTGGCTTAAACAATAAGACATTAGACGGCAAAACAAGTTATAAAATTAATGG
AAAAGGTTGGCAAAAAGATAAATCTTGGGGTGACTACAACGTTACAAGATATGAGGTCGTGAATGGCGATATTGACTTAA
AACAAGCTATTGAATCATCAGATAATATCTTCTTTGCGAGAGTTGCACTTGAATTAGGCAGCAAAAAATTCGAAGAAGGA
ATGAAACGCCTTGGTGTTGGTGAAGATATCCCGAGTGATTATCCATTCTACAATGCACAAATTTCAAATAAGAACTTAGA
TAATGAAATATTGTTAGCTGACTCAGGTTATGGCCAAGGTGAAATATTAATCAATCCTGTTCAAATTCTTTCAATATACA
GCGCATTAGAGAACAAAGGTAATGTGAATGCACCACATGTACTGAAAGATACGAAAAATAAAGTCTGGAAGAAGAACATC
ATTTCCCAGGAAAATATTAAGTTGTTAACAGACGGTATGCAACAAGTCGTTAACAAAACACATAGAGAAGATATTTATAG
ATCATATGCCAACTTAGTTGGTAAATCAGGTACAGCTGAACTCAAGATGAAACAAGGTGAGACAGGACAACAAATAGGTT
GGTTCATTTCATATGATAAAAATAATCCAAATATGATGATGGCTATTAATGTGAAAGATGTACAAGATAAAGGCATGGCA
AGTTACAATGCCAAAATATCTGGAAAAGTGTATGACGATTTATATGATAACGGTAAGAAAACATATCGTATTGATAAATA
A

>>MEG_3792|Drugs|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAATTAATCATCGCCATCGTGATTGTAATCATCGCTGTTGGTTCAGGCGTATTCTTTTATGCATCTAAAGATAA
GAAAATAAACGAAACAATTGATGCCATTGAAGATAAAAACGTTAAGCAAGTCTTTAAAAATAGTACTTACCAATCTAAAA
ACGATAATGGTGAAGTAGAAATGACAGACCGCCCTATTAAGATTTATGACAGTCTCGGCGTCAAAGATATCAACATTAAA
GATCGTGATATCAAAAAGGTTTCGAAAAACAAAAAGCAAGTCACAGCAAAGTATGAACTGCAAACGAATTACGGCAAAAT
TAATCGTGACGTTAAATTAAACTTTATTAAAGAAGATAAAGATTGGAAATTGGATTGGAATCAAAGTGTCATTATTCCAG
GCATGAAGAAAAATCAATCCATCAATATTGAACCATTGAAATCAGAACGTGGTAAGATTTTAGACCGAAACAATGTAGAG
TTAGCCACTACAGGAACAGCACATGAAGTTGGTATTGTTCCTAATAATGTTTCCACAAGTGATTACAAAGCAATCGCTGA
AAAGTTAGACCTTTCAGAATCGTATATTAAACAACAAACAGAACAGGATTGGGTTAAAGATGATACATTCGTCCCTCTCA
AGACTGTTCAAGATATGAATCAAGATTTAAAGAATTTTGTTGAAAAGTATCATCTCACATCACAGGAAACAGAAAGTCGA
GAGTATCCGTTTGAAGAAGCAACAACGCACTTACTTGGATACGTTGGCCCTATTAATTCAGAAGAATTGAAGCAAAAAGC
ATTTAAAGGTTATAAAAAGGATGCCATCGTTGGTAAAAAAGGTATCGAAAAACTATACGATAAAGAACTTCAAAATAAAG
ACGGATACCGTGTCACAATTATTGATGATCAAAATAAAGTGATAGATACATTAATCGAGAAAAAGAAAAAAGACGGTAAA
GATATTAAATTAACCATTGATGCTAGAGTCCAAAAAAGTATTTATAACAACATGAAAGATGACTACGGTTCGGGGACTGC
TATTCATCCAAAAACTGGTGAACTCTTAGCACTTGTCAGCACGCCATCTTATGATATTTATCCATTTATGAATGGAATGA
ACGATGAAGATTATAAGAAATTAACTGAAGATGATAAAGAGCCACTCCTTAATAAGTTCCAAATTACGACATCACCGGGT
TCGACTCAAAAAATATTAACAGCCATGATTGGCTTAAACAATAAGACATTAGACGGCAAAACAAGTTATAAAATTAATGG
AAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGCTACAACGTTACAAGATATGAGGTCGTGAATGGCGATATTGACTTAA
AACAAGCTATTGAATCATCAGATAATATCTTCTTTGCGAGAGTTGCACTTGAATTAGGCAGCAAAAAATTCGAAGAAGGA
ATGAAACGCCTTGGTGTTGGTAAAGATATCCCGAGTGATTATCCATTCTACAATGCACAAATTTCAAATAAGAACTTAGA
TAATGAAATATTGTTAGCTGACTCAGGTTATGGCCAAGGTGAAATATTAATCAATCCTGTTCAAATTCTTTCAATATACA
GCGCATTAGAGAACAAAGGTAATGTGAATGCACCACATGTACTGAAAGATACGAAAAATAAAGTCTGGAAGAAGAACATC
ATTTCCCAGGAAAATATTAAGTTGTTAACAGACGGTATGCAACAAGTCGTTAACAAAACACATAGAGAAGATATTTATAG
ATCATATGCCAACTTAGTTGGTAAATCAGGTACAGCTGAACTCAAGATGAAACAAGGTGAGACAGGACAACAAATAGGTT
GGTTCATTTCATATGATAAAAATAATCCAAATATGATGATGGCTATTAATGTGAAAGATGTACAAGATAAAGGCATGGCA
AGTTACAATGCCAAAATATCTGGAAAAGTGTATGACGATTTATATGATAACGGTAAGAAAACGTATCGTATTGATAAATA
A

>>MEG_3793|Drugs|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGA
TAAAGAAATTAATAAAACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCCA
AAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAAAAGTTTAGGCGTTAAAGATATAAACATT
CAAGAACGCAAAATAAAAAAAATATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAA
CATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGCATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTC
CAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTG
GAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATTAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCAC
TTAAAACCGTTAAAAAAATGGATGAAGATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAGAAAGT
CGTAACTATCCTCTAGAAGAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAA
AGAATATAAAGGTTATAAAGATGATGCAGTTGTTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATG
AAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGAT
GGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGG
TACTGCTATCCACCCTCAAACAGGTGAATTGTTAGCACTTGTAAGCACACCTTCATATGACGTGTATCCATTTATGTATG
GTATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCA
CCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAAT
CGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCG
ACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAA
AAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAA
TTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAA
TCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGCATGCAACAAGTCGTAAATAAAACACATAAAAAAGATAT
TTATAGACCTTACGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACAAA
TTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAGGA
ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGA
TGAATAA

>>MEG_3794|Drugs|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGA
TAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCTA
AAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAAAAGTTTAGGCGTTAAAGATATAAACATT
CAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAA
CATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTC
CAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTG
GAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCAC
TTAAAACCGTTAAAAAAATGGATGAAGATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAGAAAGT
CGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAA
AGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATG
AAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGAT
GGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGG
TACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATG
GCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCA
CCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAAT
CGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCG
ACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAA
AAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAA
TTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAA
TCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATAT
TTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACAAA
TTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAGGA
ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGA
TGAATAA