MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

R39

The R39 gene refers to an Ambler class D beta-lactamase found in Actinomadura R39.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1134246/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class D betalactamases

Sequences

Download Sequences

>>MEG_6040|Drugs|betalactams|Class_D_betalactamases|R39
ATGTTGTTCCCCACGGCCCGCAGGACCGGGTTCGCGGCCCTGGCCGCGCTCGCGCTCGTCCCCGCCGCGGCCTGCTCCGG
CTCCGCCGCGCCCGCCGAGGCGGAGCCGGCGAGCGCGGAGGTGACGGCCGAGGACCTCTCCGGTGAGTTCGAGCGGCTGG
AATCGGAGTTCGACGCCCGTCTCGGGGTCTACGCGGTGGACACCGGGACCGGGGAGGAGGTCTTCCACCGCGCCGACGAG
CGGTTCGGCTACGCCTCCACCCACAAGGCGTTCACGGCGGCCCTGGTCCTGGGGCAGAACACCCCCGAGGAGCTGGAGGA
GGTCGTCACCTACACCGAAGAGGACCTGGTCGACTACTCCCCCATCACCGAGCAGCACGTCGACACGGGGATGACCCTGC
TGGAGGTGGCCGACGCCGCCGTCCGCCACAGCGACAACACCGCCGCGAACCTGCTGTTCGAGGAGCTGGGCGGACCCGAG
GGGTTCGAGGAGGACATGCGGGAGCTCGGCGACGACGTGATCTCGGCGGACCGGATCGAGACCGAGCTCAACGAGGTGCC
GCCCGGCGAGACCCGGGACACGAGCACGCCGCGCGCCATGGCCGGGAGCCTGGAGGCGTTCGTGCTCGGTGACGTCCTGG
AGGAGGGCCCGCGCGACGTGCTCACCGAGATGCTCCTCAACAACACGACCGGTGACGAGCTGATCCGGGCGGGGGTCCCC
GAGGACTGGCGTGTCGGTGACAAGACCGGCGGCGGCAGCCACGGTTCGCGCAACGACATCGCCGTCGTCTGGCCCCCCGA
GGACGACCCCATCGTCATCGCGGTCATGTCCACCCGTGAGCAGGAGGACGCCGAATTCGACAACGCCCTGGTCTCGGGGG
CGACCGAGGTCGTCGTGGAGGCACTGGCCCCGTAG