MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

BLAEC

The BlaEC gene encodes an Ambler class C beta-lactamase.

References

  • http://www.ncbi.nlm.nih.gov/protein/693058861

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class C betalactamases

Sequences

Download Sequences

>>MEG_1275|Drugs|betalactams|Class_C_betalactamases|BLAEC
atgttcaaaacgacgctctgcaccttattaattaccgcctcttgctccacatttgccgcccctcaacaaatcaacgatat
tgtgcatcgcacaattaccccgcttatagagcaacaaaagatccccggtatggcggtagcggtaatttatcagggtaaac
cttattactttacctggggctatgcggacatcgccaaaaagcagcccgtcacacagcaaacgttgtttgagttaggttcg
gtcagcaaaacatttacgggcgtgcttggtggcgacgctattgctcgaggggaaatcaagttaagcgatcccacaacaaa
atactggcctgaacttaccgctaaacagtggaatgggatcacactattacatctcgcaacctacaccgctggcggcctgc
cattgcaggtgccggatgaggtgaaatcctcaagcgacttgctgcgcttctatcaaaactggcagcctgcatgggctcca
ggaacacaacgtctgtatgccaactccagtatcggtttgttcggcgcactggctgtgaagccgtctggtttgagttttga
gcaggcgatgaaaactcgtgtcttccagccactcaaactcaatcatacgtggattaatgtaccgtccgcagaagaaaaga
actacgcctggggatatcgcgaaggtaaggcagtacatgtttcgccaggggcgttagatgctgaagcttatggtgtgaag
tcgaccattgaagatatggcccgctgggtgcaaagcaatttaaaaccccttgatatcaatgagaaaacacttcaacaagg
gatacaactggcacaatctcgctactggcaaaccggcgatatgtatcagggtctgggctgggaaatgctggactggccgg
taaatcctgacatcatcattaacggcagtgacaataaaattgcactggcagcacgccccgtaaaaccgattacgccccca
actcctgcagtacgcgcatcatgggtacataaaacgggggcgaccggcggatttggtagctatgtcgcgtttattccaga
aaaagagctgggtatcgtgatgctggctaacaaaaactaccccaatccagcgagagtcgccgccgcctggcagattctca
acgctctacagtaa

>>MEG_1276|Drugs|betalactams|Class_C_betalactamases|BLAEC
atgttcaaaacgacgctctgcgccttattaattaccgcctcttgctccacatttgctgccccccaaaaaatcaacgatat
tgtgcatcgcacaattaccccgcttatagagcaacaaaagatccccggtatggcggtggcggtaatttatcagggtaaac
cttattactttacctggggctatgcggacatcgccaaaaagcagcccgtcacacagcaaacgttgtttgagttaggttcg
gtcagcaaaacatttacgggcgtgcttggtggcgacgctattgctcgaggggaaatcaagttaagcgatcccgcaacaaa
atactggcctgaacttaccgctaaacagtggaatgggatcacactattacatctcgcaacctacactgctggcggcctgc
cattgcaggtgccggatgaagtgaaatcctcaagcgacttgctgcgcttctatcaaaactggcagcctgcatgggctcca
ggaacacaacgtctgtatgccaactccagtatcggtttgttcggcgcactggctgtgaagccgtctggtttgagttttga
gcaggcgatgcaaactcgtgtcttccagccactcaaactcaaccatacatggattaatgtaccgcccgcagaagaaaaga
attacgcctggggatatcgcgaaggtaaggcagtgcatgtttcgccaggggcgttagatgctgaagcttatggtgtgaag
tcgaccattgaagatatggcccgctgggtgcaaatcaatttaaaaccccttgatatcaatgagaaaacgcttcaacaagg
gatacaagtggcacaatctcgctactggcaaaccggcgatatgtatcagggtctgggctgggaaatgctggactggccgg
taaatcctgacatcatcgttaacggcagtgacaataaaattgcactggcagcacgccccgtaaaagcgattacgccccca
actcctgcagtacgcgcatcatgggtacataaaacaggggcgaccggcggatttggtagctatgtcgcgtttattccaga
aaaagagctgggtatcgtgatgctggctaacaaaaactatcccaatccagcgagagtcgccgccgcctggcagattctca
acgctctgcagtaa

>>MEG_1277|Drugs|betalactams|Class_C_betalactamases|BLAEC
atgttcaaaacgacgctctgcaccttattaattaccgcctcttgctccacatttgccgcccctcaacaaatcaacgatat
tgtgcatcgcacaattaccccgcttatagagcaacaaaagatccccggtatggcggtggcggtaatttatcagggtaaac
cttattactttacctggggctatgcggacatcgccaaaaagcagcccgtcacacagcaaacgttgtttgagttaggttcg
gtcagcaaaacatttacgggcgtgcttggtggcgacgctattgctcgaggggaaatcaagttaagcgatcccacaacaaa
atactggcctgaacttaccgctaaacagtggaatgggatcacactattacatctcgcaacctacaccgctggcggcctgc
cattgcaggtgccggatgaggtgaaatcctcaagcgacttgctgcgcttctatcaaaactggcagcctgcatgggctcca
ggaacacaacgtctgtatgccaactccagtatcggtttgttcggcgcactggctgtgaagccgtctggtttgagttttga
gcaggcgatgaaaactcgtgtcttccagccactcaaactcaatcatacgtggattaatgtaccgtccgcagaagaaaaga
actacgcctggggatatcgcgaaggtaaggcagtacatgtttcgccaggggcgttagatgctgaagcttatggtgtgaag
tcgaccattgaagatatggcccgctgggtgcaaagcaatttaaaaccatttgatatcaatgagaaaacacttcaacaagg
gatacaactggcacaatctcgctactggcaaaccggcgatatgtatcagggtctgggctgggaaatgctggactggccgc
taaatcctgacatcatcattaacggcagtgacaataaaattgcactggcagcacgccccgtaaaaccgattacgccccca
actcctgcagtacgcgcatcatgggtacataaaacgggggcgaccggcggatttggtagctatgtcgcgtttattccaga
aaaagagctgggtatcgtgatgctggctaacaaaaactatcccaatccagcgagattcgccgccgcctggcagattctca
acgctctacagtaa

>>MEG_1278|Drugs|betalactams|Class_C_betalactamases|BLAEC
atgttcaaaacgacgctctgcgccttattaattaccgcctcttgctccacatttgccgcccctcaacaaatcaacgatat
tgtgcatcgcacaattaccccgcttatagagcaacaaaagatccccggtatggcggtggcggtaatttatcagggtaaac
cttattactttacctggggctatgcggacatcgccaaaaagcagcccgtcacacagcaaacgttgtttgagttaggttcg
gtcagcaaaacatttacgggcgtgcttggtggcgacgctattgcacgaggggaaatcaagttaagcgatcccgcgacaaa
atactggcctgaacttaccgctaaacaatggaatgggatcacactattacatcttgcgacctacaccgctggcggcctgc
cattgcaggtgccggatgacgttaaatcctcaagcgacttgctgcgcttctatcaaaactggcagcctgcatgggctcca
ggaacacaacgtctgtatgccaactccagtatcggtttgttcggcgcactggctgtgaagccgtctggtttgagttttga
gcaggcgatgcaaactcgtgtcttccagccactcaaactcaaccatacgtggattaatgtaccgcccgcagaagaaaaga
attacgcctggggatatcgcgaaggtaaggcagtgcatgtttcgccaggggcgttagatgctgaagcttatggtgtgaag
tcgaccattgaagatatggcccgctgggtgcaaagcaatttaaaaccccttgatatcactgagaaaacgcttcaacaagg
gatacaactggcacaatctcgctactggcaaaccggcgatatgtatcagggcctgggctgggaaatgctggactggccgg
taaatcctgacagcatcattaacggcagtgacaataaaattgcactggcagcacgccccgtaaaagcgattacgccccca
actcctgcagtgcgcgcatcatgggtacataaaacaggggcgaccggcggatttggtagctatgtcgcgtttattccaga
aaaagagctgggtatcgtgatgctggctaacaaaaactatcccaatccagcgagagtcactgccgcctggcagattctca
acgctctacagtaa

>>MEG_1279|Drugs|betalactams|Class_C_betalactamases|BLAEC
atgttcaaaacgacgctctgcgccttattaattaccgcctcttgctccacatttgctgcccctcaacaaatcaacgatat
tgtgcatcgcacaattaccccgcttatagagcaacaaaagatccccggtatggcggtggcggtaatttatcagggtaaac
cttattactttacctggggctatgcggacatcgccaaaaagcagcccgtcacacagcaaacgttgtttgagttaggttcg
gtcagcaaaacatttacgggcgtgcttggtggcgacgctattgctcgaggggaaatcaagttaagcgatcccacaacaaa
atactggcctgaacttaccgctaaacagtggaatgggatcacactattacatctcgcaacctacactgctggcggcctgc
cattgcaggtgccggatgaggtgaaatcctcaagcgacttgctgcgcttctatcaaaactggcagcctacatgggcgcca
ggaacacaacgtctgtatgccaactccagtatcggtttgttcggcgcactggctgtgaagccgtctggtttgagttttga
gcaggcgatgcaaacacgtgtcttccagccactcaaactcaaccatacgtggattaatgtacctcccccagaagaaaaga
attacgcctggggatatcgcgaaggtaaggcagtgcatgtttcgccaggggcgttagatgctgaagcttatggtgtgaag
tcgaccattgaagatatggcccgctgggtacgaagcaatatgaatccccgtgatatcaacgacaaaacacttcagcaagg
gatacaactggcacaatctcgctactggcaaaccggcgatatgtatcagggcctgggctgggaaatgctggactggccgg
taaatcctgacagcatcattaacggcagtggcaataaaattgcactggcagcacaccctgtaaaagcgattacgccccca
actcctgcagtacgcgcatcatgggtacataaaacaggggcaaccggcggatttggtagctatgtcgcgtttattccaga
aaaagagctgggtatagtgatgctggctaacaaaaactatcccaatccagcgagattcgccgccgcctggcagattctca
acgctctacagtaa

>>MEG_1280|Drugs|betalactams|Class_C_betalactamases|BLAEC
atgttcaaaacgacgctctgcgccttattaattaccgcctcttgctccacatttgctgcccctcaacaaatcaacgatat
tgtgcatcgcacaattaccccgcttatagagcaacaaaagatccccggtatggcggtggcggtaatttatcagggtaaac
cttattactttacctggggctatgcggacatcgccaaaaagcagcccgtcacacagcaaacgttgtttgagttaggttcg
gtcagcaaaacatttacgggcgtgcttggtggcgacgctattgctcgaggggaaatcaagttaagcgatcccgcaacaaa
atactggcctgaacttaccgctaaacagtggaatgggatcacactattacatcttgcgacctacaccgctggcggcctgc
cattgcaggtgccggatgaagtgaaatcctcaagcgacttgctgcgcttctatcaaaactggcagcctgcatgggctcca
ggaacacaacgtctgtatgccaactccagtatcggtttgttcggcgcactggctgtgaagccgtctggtttgagttttga
gcaggcgatgcaaactcgtgtcttccagccactcaaactcaaccatacgtggattaatgtacctcccccagaagaaaaga
attacgcctggggatatcgcgaaggtaaggcagtgcatgtttcgccaggggcgttagatgctgaagcttatggtgtgaag
tcgaccattgaagatatggcccgctgggtacgaagcaatatgaatccccgtgatatcaacgacaaaacacttcagcaagg
gatacaactggcacaatctcgctactggcaaaccggcgatatgtatcagggcctgggctgggaaatgctggactggccgg
taaatcctgacagcatcattaacggcaatggcaataaaattgcactggcagcacaccctgtaaaagcgattacgccccca
actcctgcagtacgcgcatcatgggtacataaaacaggggcaaccggcggatttggtagctatgtcgcgtttattccaga
aaaagagctgggtatagtgatgctggctaacaaaaactatcccaatccagcgagagtcgccgccgcctggcagattctca
acgctctacagtaa

>>MEG_1281|Drugs|betalactams|Class_C_betalactamases|BLAEC
atgttcaaaacgacgctctgcgccttattaattaccgcctcttgctccacatttgctgcccctcaacaaatcaacgatat
tgtgcatcgcacaattaccccgcttatagagcaacaaaagatccccggtatggcggtggcggtaatttatcagggtaaac
cttattactttacctggggctatgcggacatcgccaaaaagcagcccgtcacacagcaaacgttgtttgagttaggttcg
gtcagcaaaacatttacgggcgtgcttggtggcgacgctattgctcgaggggaaatcaagttaagcgatcccgcaacaaa
atactggcctgaacttaccgctaaacagtggaatgggatcacactattacatcttgcgacctacaccgctggcggcctgc
cattgcaggtgccggatgaagtgaaatcctcaagcgacttgctgcgcttctatcaaaactggcagcctgcatgggctcca
ggaacacaacgtctgtatgccaactccagtatcggtttgttcggcgcactggctgtgaagccgtctggtttgagttttga
gcaggcgatgcaaactcgtgtcttccagccactcaaactcaaccatacgtggattaatgtacctcccccagaagaaaaga
attacgcctggggatatcgcgaaggtaaggcagtgcatgtttcgccaggggcgttagatgctgaagcttatggtgtgaag
tcgaccattgaagatatggcccgctgggtacgaagcaatatgaatccccgtgatatcaacgacaaaacacttcagcaagg
gatacaactggcacaatctcgctactggcaaaccggcgatatgtatcagggcctgggctgggaaatgctggactggccgg
taaatcctgacagcatcattaacggcagtggcaataaaattgcactggcagcacaccctttaaaagcgattacgccccca
actcctgcagtacgcgcatcatgggtacataaaacaggggcaaccggcggatttggtagctatgtcgcgtttattccaga
aaaagagctgggtatagtgatgctggctaacaaaaactatcccaatccagcgagagtcgccgccgcctggcagattctca
acgctctacagtaa

>>MEG_1282|Drugs|betalactams|Class_C_betalactamases|BLAEC
atgttcaaaacgacgctctgcgccttattaattaccgcctcttgctccacatttgctgcccctcaacaaatcaacgatat
tgtgcatcgcacaattaccccgcttatagagcaacaaaagatccccggtatggcggtggcggtaatttatcagggtaaac
cttattactttacctggggctatgcggacatcgccaaaaagcagcccgtcacacagcaaacgttgtttgagttaggttcg
gtcagcaaaacatttacgggcgtgcttggtggcgacgctattgctcgaggggaaatcaagttaagcgatcccgcaacaaa
atactggcctgaacttaccgctaaacagtggaatgggatcacactattacatcttgcgacctacaccgctggcggcctgc
cattgcaggtgccggatgaagtgaaatcctcaagcgacttgctgcgcttctatcaaaactggcagcctgcatgggctcca
ggaacacaacgtctgtatgccaactccagtatcggtttgttcggcgcactggctgtgaagccgtctggtttgagttttga
gcaggcgatgcaaactcgtgtcttccagccactcaaactcaaccatacgtggattaatgtacctcccccagaagaaaaga
attacgcctggggatatcgcgaaggtaaggcagtgcatgtttcgccaggggcgttagatgctgaagcttatggtgtgaag
tcgaccattgaagatatggcccgctgggtacgaagcaatatgaatccccgtgatatcaacgacaaaacacttcagcaagg
gatacaactggcacaatctcgctactggcaaaccggcgatatgtatcagggcctgggctgggaaatgctggactggccgg
taaatcctgacagcatcattaacggcagtggcaataaaattgcactggcagcaccccctgtaaaagcgattacgccccca
actcctgcagtacgcgcatcatgggtacataaaacaggggcaaccggcggatttggtagctatgtcgcgtttattccaga
aaaagagctgggtatagtgatgctggctaacaaaaactatcccaatccagcgagagtcgccgccgcctggcagattctca
acgctctacagtaa

>>MEG_1283|Drugs|betalactams|Class_C_betalactamases|BLAEC
atgttcaaaacgacgctctgcgccttattaattaccgcctcttgctccacatttgctgcccctcaacaaatcaacgatat
tgtgcatcgcacaattaccccgcttatagagcaacaaaagatccccggtatggcggtggcggtaatttatcagggtaaac
cttattactttacctggggctatgcggacatcgccaaaaagcagcccgtcacacagcaaacgttgtttgagttaggttcg
gtcagcaaaacatttacgggcgtgcttggtggcgacgctattgctcgaggggaaatcaagttaagcgatcccgcaacaaa
atactggcctgaacttaccgctaaacagtggaatgggatcacactattacatcttgcgacctacaccgctggcggcctgc
cattgcaggtgccggatgaagtgaaatcctcaagcgacttgctgcgcttctatcaaaactggcagcctgcatgggctcca
ggaacacaacgtctgtatgccaactccagtatcggtttgttcggcgcactggctgtgaagccgtctggtttgagttttga
gcaggcgatgcaaactcgtgtcttccagccactcaaactcaaccatacgtggattaatgtacctcccccagaagaaaaga
attacgcctggggatatcgcgaaggtaaggcagtgcatgtttcgccaggggcgttagatgctgaagcttatggtgtgaag
tcgaccattgaagatatggcccgctgggtacgaagcaatatgaatccccgtgatatcaacgacaaaacacttcagcaagg
gatacaactggcacaatctcgctactggcaaaccggcgatatgtatcagggcctgggctgggaaatgctggactggccgg
taaatcctgacagcatcattaacggctgtggcaataaaattgcactggcagcacaccctgtaaaagcgattacgccccca
actcctgcagtacgcgcatcatgggtacataaaacaggggcaaccggcggatttggtagctatgtcgcgtttattccaga
aaaagagctgggtatagtgatgctggctaacaaaaactatcccaatccagcgagagtcgccgccgcctggcagattctca
acgctctacagtaa

>>MEG_1284|Drugs|betalactams|Class_C_betalactamases|BLAEC
atgttcaaaatcacgctctgcgccttattaattaccgcctcttgctccacatttgctgcccctcaacaaatcaacgatat
tgtgcatcgcacaattaccccgcttatagagcaacaaaagatccccggtatggcggtggcggtaatttatcagggtaaac
cttattactttacctggggctatgcggacatcgccaaaaagcagcccgtcacacagcaaacgttgtttgagttaggctcg
gtcagcaaaacatttacgggcgtacttggtggcgacgctattgcacgaggggaaatcaagttaagcgatcccgcgacaaa
atactggcctgaacttaccgctaaacaatggaatgggatcacactattacatcttgcgacctacaccgctggcggcctgc
cattgcaggtgccggatgaggtgaaatcctcaagcgacttgctgcgcttctatcaaaactggcaacctgcatggactcca
ggaacacaacgtctgtatgccaacaccagtattgggttgttcggtgcactggcggtgaaaccatccggtttgagctttga
acaggcaatgcaaactcgtgtcttccagccactcaaactcaaccatacgtggattaatgtaccgcccgcagaagaaaaga
attacgcctggggatatcgcgaaggtaaggcagtgcatgtttcgccaggggcgttagatgctgaagcttatggtgtgaag
tcgaccattgaagatatggcccgctgggtgcaaagcaatttaaaaccccttgatatcactgagaaaacgcttcaacaagg
gatacaactggcacaatctcgctactggcaaaccggcgatatgtatcagggcctgggctgggaaatgcaggactggccgg
taaatcctgacatcatcattaacggcagtgacaataaaattgcactggcagcacgccccgtaaaagcgattacgccccca
actcctgcagtgcgcgcatcatgggtacataaaacgggagcgaccggcggatttggtagctatgtcgcgtttattccaga
aaaagagctgggtatcgtgatgctggctaacaaaaactatcccaatccagcgagagtcactgccgcctggcagattctca
acgctctacagtaa