Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TUS

The TUS genes encode Ambler class B beta-lactamases.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/12384365

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class B betalactamases

Sequences

Download Sequences

>>MEG_7326|Drugs|betalactams|Class_B_betalactamases|TUS
ATGTACCACTACTTTAGCAGTTTATTTGTACTGATTTTTTCTACTTTGGTCTATCCTCAATCGGATAAATTAAAAATTGA
GCCGTTGAACGATCATATGTATGTCTATACGACCTACCAAGTATTTCAAGGCGTCGAATATTCTTCCAATGCTTTATATG
TAGTGACGGATGAAGGAGTAATTCTCATTGATACCCCTTGGGATAAAGATCAGTACGCCCCTTTAGTAGAACACATCAGA
CGTGAACATAACAAAGAAATAAAATGGGTCATTACCACTCACTTCCACGAAGATCGTTCGGGTGGACTTGATTACTTCAA
TAAAGCTGGAGCAGAAACCTATACTTATGCTTTGACCAACGAAATCTTAAAACAGCGCAATGAACCACAAGCGACTTTTA
CTTTTGGTTCAACAAAGCAGTTCAACTTGGGCAAAGAAAAAATAGAGGTCTATTTCTTAGGAGAAGGTCATAGTAAAGAT
AATACGGTGGTTTGGTTTCCAGAAGAAGCGATTTTATACGGTGGTTGTTTGATTAAAAGTGCAGAGGCAACGACTATCGG
CAATATCGTCGATGGCAATGTAGAGGCTTGGCCTACGACAATCAAAGCCGTAAAGCGCAAATTCAAAAAGGCCAAAGTGA
TTATTCCAGGGCATGATGCCTGGAATCAATCCGGTCATCTTGAAAATACAGCCCGTATCTTATCGGCTTATCAGGCACAA
AAATTAAAGAACAACAAGCAATTATAA