MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

THINB

The THIN-B gene encodes an Ambler class B beta-lactamase.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/15561856

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class B betalactamases

Sequences

Download Sequences

>>MEG_7249|Drugs|betalactams|Class_B_betalactamases|THINB
ATGACACTATTGGCGAAGTTGATGCTGGCGACGGTTGCGACCATGTCGGCGGCTACGGTGCAGGCAAAGACACCGGCGCC
CAAGCCGGATACCCCTGTCGATTGCGACAGCTGCAAGGCGTGGAACGGGGAAGTCACACCATTCAACGTATTTGGCAATA
CCTGGTATGTGGGCACGGCCGGCTTGTCCGCCGTGCTGGTGACCAGCCCGCAAGGCCACGTCCTGCTCGACGGCGCGCTG
CCGCAATCGGCGCCACTGATCATCGCGAACATCGCGGCGCTGGGTTTCCGCATCGAGGATGTGAAATTCATCCTCAATTC
CCACGCGCATTGGGATCACGCCGGCGGCATCGCCGCGCTGCAGGCCGCCAGCGGCGCCACCGTGGTGGCCAGCGCCTCGG
GCGCCCTGGGATTGCAAAGCGGCACCAACGGCAAGGATGATCCGCAATTCCAGGCCAAGCCTGTCGTGCATGTGGCAAAG
GTGGAGAAGGTCAAGGTGGTGGGCGAGGGCGATGCCATCAAGCTGGGGCCGTTGAACCTGACGGCGCACATGACGCCAGG
CCACACGCCAGGCGCCACCACCTGGACCTGGACCTCGTGCGAAGGGCAGCGCTGCCTGGACGTGGTGTATGCCGACAGCC
TGAATCCGTATTCCAGCGGCGACTTTACGTACACGGGCAAAGGGGACGGACCCGATATCTCGGCCTCGTTTGCCGCCAGC
ATCGCCAAGGTGGCGGCCCTGCCGTGCGACATCATTCTTTCCGTGCATCCCGATTCGACGGGCGTGCTGGACAAGGCGGC
CAAGCGCAGCGGCGAACACAATCCCTTCATCGATGCGAACGCCTGCCGCGCCTATGCGGCCACGGCGGACGCCATGCTGA
CGAAACGGCTGGCGAAGGAGCGCGGCGTGGCCCTGCCTGCGGCGGCCCCGGCTGCCCAGCACGCGCACTAG