MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

L1

The L1 gene encodes an Ambler class B beta-lactamase.

References

  • http://aac.asm.org/content/45/3/660

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class B betalactamases

Sequences

Download Sequences

>>MEG_3517|Drugs|betalactams|Class_B_betalactamases|L1
atgcgcctctgcctgactcccctcgccctggctgccacgctcgtcttcgatgtcgctgccgccgacgcaccgctgccgca
gctccgggcctacaccgtcgacgcttcgtggctgcagccgatggcaccgctgcagattgccgaccacacctggcagatcg
gcaccgaggacctgacggcactgctggtgcgaaccaccgggggcgcagtgctattggatggcggcatgccgcagatggcc
ggtcacctgctggacaacatgaaggcacgcggggtggcaccacaggatctacggctgatcctgctcagccatgcgcatgc
cgaccacgccgggccggtggcggaactcaagcgccgcaccggtgcccaggtggtcgcgaacgccgaaacggccgtgctgc
tgccgcgcggcagcagcaacgacctgcacttcggtgatgacatcacctacccgccggccagtgccgaccgcatcatcatg
gatggtgagagggtgacggtaggcggcatggcattcaccgcgcacttcatgccagggcacacccccggcagcaccgcctg
gacctggaccgatacccgcgatggcaagcccgtgcgcatcgcctacgccgacagcctgagtgcgccgggctaccagctgc
agtacaacgcacgctatccccgcctggtcgaggactaccggcgcagcttcacaacggtgcgcggcctgccctgcgacctg
ctgctgaccccgcatccgggcgccagccgctggaactatgccgccggtgccgaggccggggccaacgtcctgacctgcaa
ggcctacgcggatgcggccgagaaggcattcgacgcgcagttggccaagggaacgaccggggcccgctga

>>MEG_3518|Drugs|betalactams|Class_B_betalactamases|L1
atgcgcctctgcctgactcccctcgccctggctgccacgctcgtcttcgatgtcgctgccgccgacgcaccgctgccgca
gctccgggcctacaccgtcgacgcttcgtggctgcagccgatggcaccgctgcagattgccgaccacacctggcagatcg
gcaccgaggacctgacggcactgctggtgcggaccaccgagggcgcagtgctattggatggcggcatgccgcagatggcc
ggtcacctgctggacaacatgaaggcacgcggggtggcaccacaggatctacggctgatcctgctcagccatgcgcatgc
cgaccacgccgggccggtggcggaactcaagcgccgcaccggtgcccaggtggtcgcgaacgccgaaacggccgtgctgc
tgccgcgcggcggcagcaacgacctgcacttcggtgatgacatcacctacccgccggccagtgccgaccgcatcatcatg
gatggtgagagggtgacggtaggcggcatggcattcaccgcgcacttcatgccagggcacacccccggcagcaccgcctg
gacctggaccgatacccgcgatggcaagcccgtgcgcatcgcctacgccgacagcctgagtgcgccgggctaccagctgc
agtacaacgcacgctatccccgcctggtcgaggactaccggcgcagcttcacaacggtgcgcggcctgccctgcgacctg
ctgctgaccccgcatccgggcgccagccgctggaactatgccgccggtgccgaggccggggccaacgtcctgacctgcaa
ggcctacgcggatgcggccgagaaggcattcgacgcgcagttggccaaggaaacgaccggggcccgctga

>>MEG_3519|Drugs|betalactams|Class_B_betalactamases|L1
atgcgcctctgcctgactcccctcgccctggctgccacgctcgtctttgatgtcgccgccgccgacgcaccgctgccgca
gctccgggcctacaccgtcaacgcttcgtggctgcagccgatggcaccgctgcaaattgccgaccacacctggcaaatcg
gcaccgaggacctgaccgcactgctggtgcaaaccaccgagggcgcagtgctattggatggcggcatgccgcaaatggcc
ggtcacctgctggacaacatgaaggcacgcggggtggcaccacaggatctacggctgatcctgctcagccatgcgcatgc
cgaccatgccgggccggtggcggaactgaagcgccgcaccggtgccacggtggtcgcgaacgccgaaacggccgtgctgc
ttgcgcgcggcggcagcaacgacctgcacttcggtgatgacatcacctacccgccggccagtgccgaccgcaccatcatg
gatggtgaaagggtgacggtaggcggcatggcattcaccgcgcacttcatgcctgggcacacccccggcagcaccgcctg
gacctggaccgatagccgcgatggcaagcccgtgcgcatcgcctacgccgacagcctgagtgcgccgggctaccagctgc
agcacaacgcacgctatccccgactggtcgaggactactggcgcagcttcacgacggtgcgcggcctgccctgcgacctg
ctgctgaccccgcatccgggcgccagccgctggaactatgccgccggtgccgaggccggggccaacgtcctgacctgcaa
ggcctacgcggatgcggccgagaaggcgttcgacgcgcagttggccaaggaagcggccggggcccgctga

>>MEG_3520|Drugs|betalactams|Class_B_betalactamases|L1
atgcgcctctgcctgactcccctcgccctggctgccacgctcgtctttgatgtcgctgccgccgacgcaccgctgccgca
gctccgggcctacaccgtcgacgcttcgtggctgcagccgatggcaccgctgcagattgccgaccacacctggcagatcg
gcaccgaggacctgacggcactgctggtgcagaccaccgagggcgcagtgctattggatggcggcatgccgcagatggcc
ggtcacctgctggacaacatgaaggcacgcgaggtggcaccacaggatctacggctgatcctgctcagccatgcgcatgc
cgaccacgccgggccggtggcggaactcaagcgccgcaccggtgcccaggtggtcgcgaacgccgaaacggccgtgctgc
taccgcgcggcggcagcaacgacctgcacttcggtgatgacatcacctacccgccggccagtgccgaccgcatcatcatg
gatggtgagagggtgacggtaggcggcatggcattcaccgcgcacttcatgccagggcacacccccggcagcaccgcctg
gacctggaccgatacccgcgatggcaagcccgtgcgcatcgcctacgccgacagcctgagtgcgccgggctaccagctgc
agtacaacgcacgctatccccgcctggtcgaggactaccggcgcagcttcacgacggtgcgcggcctgccctgcgacctg
ctgccgaccccgcatccgggcgccagccgctggaactatgccgccggtgccgaggccggggccaacgtcctgacctgcaa
ggcctacgcggatgcggccgagaaggcattcgacgcgcagttggccaaggaaacgaccggggcccgctga

>>MEG_3521|Drugs|betalactams|Class_B_betalactamases|L1
atgcgcctttgcctgacgacccttgccctgactgccacacttgcctttgatgtgactgccgccgacgcaccgctgccgca
gctgcaggcctacaccgtggacgcctcgtggctgcagccgatggcaccgctgcagattgccgaccgcacctggcagatcg
gcaccgaggacctgaccgcgctgctggtgcagaccgccgacggtgcggtactgctcgacggcggcatgccgcagatggcc
ggtcacctgctggacaacatgaaggcacgcggggtggcagcacaggatctacggctgatcctgctcagccacgcacacgc
cgaccatgccgggccagtggcggagctgaagcgccgtaccggcgccagcgtagcggccaacgccgaatcggccgtgctgc
tggcgcgcggtggcagcaacgacctgcactttggcgacagcatcacctttccgccggccagcgccgaccgcatcatcatg
gatggcgaagaggtcaccgtaggcggcatcgcgttcaccgcgcacttcatgccggggcacaccccaggcagcaccgcctg
gacctggaccgatacccgcgatggccagccggtgcgcatcgcctacgccgacagcctgagtgcgccgggctaccagctgc
agggcaacgcccgttatccccgcctggtcgaggactaccggcgcagcttcgctacggtgcgcggcctgccctgcgacctg
ctgctgacgccgcatccgggcgccagcaactggaactatgccgccggtgcagaggccggagccaacgccctgacctgcaa
ggcctacgcggatgcggccgagaagaagttcgacgcacagctggccaaggaaacagccacggcacgctga

>>MEG_3522|Drugs|betalactams|Class_B_betalactamases|L1
atgcgcctttgcctgacgacctttgccctgactgccacacttgcctttgatgtgactgccgccgacgcaccgctgccgca
gctgcaggcctacaccgtggacgcctcgtggctgcagccgatggcaccgctgcagattgccgaccgcacctggcagatcg
gcaccgaggacctgaccgcgctgctggtgcagaccgccgacggtgcggtactgctcgacggcggcatgccgcagatggcc
ggtcacctgctggacaacatgaaggcacgcggggtggcagcacaggatctacggctgatcctgctcagccacgcacacgc
cgaccatgccgggccagtggcggagctgaagcgccgtaccggcgccagcgtagcggccaacgccgaatcggccgtgctgc
tggcgcgcggtggcagcaacgacctgcactttggcgacagcatcacctttccgccggccagcgccgaccgcatcatcatg
gatggcgaagaggtcaccgtaggcggcatcgcgttcaccgcgcacttcatgccggggcacaccccaggcagcaccgcctg
gacctggaccgatacccgcgatggccagccggtgcgcatcgcctacgccgacagcctgagtgcgccgggctaccagctgc
agggcaacgcccgttatccccgcctggtcgaggactaccggcgcagcttcgctacggtgcgcggcctgccctgcgacctg
ctgctgacgccgcatccgggcgccagcaactggaactatgccgccggtgcagaggccggagccaacgccctgacctgcaa
ggcctacgcggatgcggccgagaagaagttcgacgcacagctggccaaggaaacagccacggcacgctga

>>MEG_3523|Drugs|betalactams|Class_B_betalactamases|L1
atgcgttctaccctgctcgccttcgccctggccgtcgctcttccggccgcccacgccagcgccgccgaggcaccgctgcc
acaactgcgggcctataccgtggatgcgtcctggctgcagccgatagcgccgctgcaggttgccgaccacacctggcaga
tcggcaccgaggacctgaccgcgctgctggtgcagaccgccgagggcgcagtactgctggatggcggcatgccacagatg
gccggtcacctgctggacaacatgaagctgcgcggcgtggccccgcaggacctgcgattgatcctgctcagccatgcgca
tgccgaccacgccggcccggtcgccgagctcaagcgtcgcaccggcgcgcatgtggcggccaatgcagaaacggcggtgc
tgctggcgcgcggcggcagcaacgacctgcactttggcgacggcatcacctatccgccggccagcgccgaccgcatcatc
atggatggcgaagtggtcacggtgggcggcatcgcgttcaccgcgcacttcatgccagggcacaccccgggcagcaccgc
ctggacctggaccgacacccgcgatggcaagccggtgcgcatcgcctacgccgacagcctcagcgcaccgggttaccagc
tgaagggcaatccccgttatccgcgcctgatcgaggactacaagcgcagcttcgcaacggtgcgggcgctgccctgcgat
ctgctgctcaccccgcatccgggcgccagcaactggaactacgccgccggcagcaaggccagcaccgaggcactgacctg
caacgcctacgcggatgcggccgagaagaagttcgacgcgcagctggccaaggaaacggccggggcccgctga

>>MEG_3524|Drugs|betalactams|Class_B_betalactamases|L1
atgcgttctaccctgctcgccttcgccctggccgtcgctcttccgtccgcccacgccagcgccgccgaggcaccgctgcc
acaactgcgggcctataccgtggatgcgtcctggctgcagccgatggcgccgctgcaggttgccgaccacacctggcaga
tcggcaccgaggacctgaccgcgctgctggtgcagaccgccgagggcgcagtactgctggatggcggcatgccacagatg
gccggtcacctgctggacaacatgaagctgcgcggcgtggccccgcaggacctgcgattgatcctgctcagccatgcgca
tgccgaccacgccggcccggtcgccgagctcaagcgtcgcaccggcgcgcatgtggcggccaatgcagaaacggcggtgc
tgctggcgcgcggcggcagcaacgacctgcactttggcgacggcatcacctatccgccggccagcgccgaccgcatcatc
atggacggcgaagtggtcacggtgggcggcatcgcattcaccgcgcacttcatgccggggcacaccccgggcagcaccgc
ctggacctggaccgacacccgcgatgggaagccggtgcgcatcgcctacgccgacagcctgagtgcaccgggttaccagc
tgaagggcaatccccgttatccgcgcctgatcgaggactacaagcgcagcttcgcaacggtacgggcgctgccctgcgat
ctgctgctcaccccgcatccgggcgccagcaactggaactacgccgtcggcagcaaggccagcgccgaggcactgacctg
caacgcctacgcggatgcggccgagaagaagttcgacgcgcagctggccaaggaaacggccggggcccgctga

>>MEG_3525|Drugs|betalactams|Class_B_betalactamases|L1
atgcgttctaccctgctcgccttcgccctggccgtggccctcccgatcgcgcacgccagtggcgccgagacaccactgcc
gcagctgcgggcctacaccgtggacgcctcgtggctgcagccgatggcaccgctgcagattgccgaccacacctggcaga
tcggcacgcaggacctgaccgccctgctggtgcagaccgctgacggcgcggtactgctcgacggcggcatgccacagatg
gccggccacctcatcagcaacatgaaggtgcgcggcgtggcgccgcaggacctgcggctgatcctgctcagccacgcgca
cgccgaccatgccgggccggtggcggagctgaagcgccgtacgggcgccaaagtagcggccaacgccgaatcggcggtgc
tgctggcgcgcggtggcagcgacgatctgcacttcggcgatggcatcacctacccgcctgccagtgcagaccgcatcgtc
atggatggcgaaatgatcacggtgggcggcatcgcgttcactgcgcacttcatgccggggcacaccccgggcagcaccgc
gtggacctggaccgatacccgcgagggcaagccggtgcgcatcgcctacgccgacagcctgagtgcaccgggctaccagc
tgcagggcaacccccgttatccgcacctgatcgaggattacaggcacagcttagcgacggtgcgggcgctgccctgcgac
gtgttgctgacaccgcatccgggtgccagcaactgggactacgctgccggcagcaaggccagcgccaaggcactgacctg
caaggcctacgcggatgcggccgaacagaagttcgacgcacagctggccaaggaaacggccggggcccgctga

>>MEG_3526|Drugs|betalactams|Class_B_betalactamases|L1
atgcgttttaccctgctcgccttcgccctggccgtcgcgcttccggccgcccacgccagcgccgccgaggcaccgctgcc
acaactgcgggcctataccgtggatgcgtcctggctgcagccgatggcgccgctgcaggttgccgaccacacctggcaga
tcggcaccgaggacctgaccgcgctgctggtgcagaccgccgagggcgcagtactgctggatggcggcatgccacagatg
gccggtcacctgctggacaacatgaaactgcgcggcgtggccccgcaggacctgcgattgatcctgctcagccatgcgca
tgccgaccacgccggcccggtcgccgagctcaagcgtcgcaccggcgcgcatgtggcggccaatgcagaaacggcggtgc
tgctggcgcgcggcggcagcaacgacctgcactttggcgacggcatcacctatccgccggccagcgccgaccgcatcatc
atggatggcgaagtggtcacggtgggcggcatcgcattcaccgcgcacttcatgccggggcacaccccgggcagcaccgc
ctggacctggaccgacacccgcgatgggaagccggtgcgcatcgcctacgccgacagcctgagtgcaccgggttaccagc
tgaagggcaatccccgttatccgcgcctgatcgaggactacaagcgcagcttcgcaacggtacgggcgctgccctgcgat
ctgctgctcaccccgcatccgggcgccagcaactggaactatgccgccggcagcaaggccagcgccgaggcactgacctg
caacgcctacgcggatgcggccgagaagaagttcgacgcgcagttggccagggaaacggccgggacccgctga

>>MEG_3527|Drugs|betalactams|Class_B_betalactamases|L1
atgcgttttaccctgctcgccttcgccctggccgtcgcgcttccggccgcccacgccagcgccgccgaggcaccgctgcc
acaactgcgggcctataccgtggatgcgtcctggctgcagccgatggcgccgctgcaggttgccgaccacacctggcaga
tcggcaccgaggacctgaccgcgctgctggtgcagaccgccgagggcgcagtactgctggatggcggcatgccacagatg
gccggtcacctgctggacaacatgaaactgcgcggcgtggccccgcaggacctgcgattgatcctgctcagccatgcgca
tgccgaccacgccggcccggtcgccgagctcaagcgtcgcaccggcgcgcatgtggcggccaatgcagaaacggcggtgc
tgctggcgcgcggcggcagcaacgacctgcactttggcgacggcatcacctatccgccggccagcgccgaccgcatcatc
atggatggcgaagtggtcacggtgggcggcatcgcattcaccgcgcacttcatgccggggcacaccccgggcagcaccgc
ctggacctggaccgacacccgcgatgggaagccggtgcgcatcgcctacgccgacagcctgagtgcaccgggttaccagc
tgaagggcaatccccgttatccgcgcctgatcgaggactacaagcgcagcttcgcaacggtacgggcgctgccctgcgat
ctgctgctcaccccgcatccgggcgccagcaactggaactatgccgccggcagcaaggccagcgccgaggcactgacctg
caatgcctacgcggatgcggccgagaagaagttcgacgcgcagttggccagggaaacggccggggcccgctga

>>MEG_3528|Drugs|betalactams|Class_B_betalactamases|L1
atgcgttttaccctgctcgccttcgccctggccgtcgcgcttccggccgcccacgccagcgccgccgaggcaccgctgcc
acaactgcgggcctataccgtggatgcgtcctggctgcagccgatggcgccgctgcaggttgccgaccacacctggcaga
tcggcaccgaggacctgaccgcgctgctggtgcagaccgccgagggcgcagtactgctggatggcggcatgccacagatg
gccggtcacctgctggacaacatgaaactgcgcggcgtggccccgcaggacctgcgattgatcctgctcagccatgcgca
tgccgaccacgccggcccggtcgccgagctcaagcgtcgcaccggcgcgcatgtggcggccaatgcagaaacggcggtgc
tgctggcgcgcggcggcagcaacgacctgcactttggcgacggcatcgcctatccgccggccagcgccgaccgcatcatc
atggatggcgaagtggtcacggtgggcggcatcgcattcaccgcgcacttcatgccggggcacaccccgggcagcaccgc
ctggacctggaccgacacccgcgatgggaagccggtgcgcatcgcctacgccgacagcctgagtgcaccgggttaccagc
tgaagggcaatccccgttatccgcgcctgatcgaggactacaagcgcagcttcgcaacggtacgggcgctgccctgcgat
ctgctgctcaccccgcatccgggcgccagcaactggaactatgccgccggcagcaaggccagcgccgaggcactgacctg
caatgcctacgcggatgcggccgagaagaagttcgacgcgcagttggccagggaaacggccgggacccgctga

>>MEG_3529|Drugs|betalactams|Class_B_betalactamases|L1
atgcgttttaccctgctcgccttcgccctggccgtcgctcttccggccgtccacgccagcgccgccgaggcaccgctgcc
acaactgcgggcctataccgtggatgcgtcccggctgcagccgatggcgccgctgcaggttgccgaccacacctggcaga
tcggcaccgaggacctgaccgcgctgctggtgcagaccgccgagggcgcagtactgctggatggcggcatgccacagatg
gccggtcacctgctggacaacatgaagctgcgcggcgtggccccgcaggacctgcgattgatcctgctcagccatgcgca
tgccgaccacgccggcacggtcgccgagctcaagcgtcgcaccggcgcgcatgtggcggccaatgcagaaacggcggtgc
tgctggcgcgcggcggcagcaacgacctgcactttggcgacggcatcacctatccgccggccagcgccgaccgcatcatc
atggatggcgaagtggtcacggtgggcggcatcgcattcaccgcgcacttcatgccggggcacaccccgggcagcaccgc
ctggacttggaccgacacccgcgatgggaagccggtgcgcatcgcctacgccgacagcctgagtgcaccgggttaccagc
tgaagggcaatccccgttatccgcgcttgatcgaggactacaagcgcagcttcgcaacggtacgggcgctgccctgcgat
ctgctgctcaccccgcatccgggcgccagcaactggaactatgccgccggcagcaaggccagcgccgaggcactgacctg
caacgcctacgcggatgcggccgagaagaagttcgacgcgcagttggccagggaaacggccgggacccgctga

>>MEG_3530|Drugs|betalactams|Class_B_betalactamases|L1
atgcgttttaccctgctcgccttcgccctggccgtcgctcttccggccgtccacgccagcgccgccgaggcaccgctgcc
acaactgcgggcctataccgtggatgcgtcctggctgcagccgatggcgccgctgcaggttgccgaccacacctggcaga
tcggcaccgaggacctgaccgcgctgctggtgcagaccgccgagggcgcagtactgctggatggcggcatgccacagatg
gccggtcacctgctggacaacatgaagctgcgcggcgtggccccgcaggacctgcgattgatcctgctcagccatgcgca
tgccgaccacgccggcccggtcgccgagctcaagcgtcgcaccggcgcgcatgtggcggccaatgcagaaacggcggtgc
tgctggcgcgcggcggcagcaacgacctgcactttggcgacggcatcacctatccgccggccagcgccgaccgcatcatc
atggacggcgaagtggtcacggtgggcggcatcgcattcaccgcgcacttcatgccggggcacaccccgggcagcaccgc
ctggacctggaccgacacccgcgatgggaagccggtgcgcatcgcctacgccgacagcctgagtgcaccgggttaccagc
tgaagggcaatccccgttatccgcgcttgatcgaggactacaagcgcagcttcgcaacggtacgggcgctgccctgcgat
ctgctgctcaccccgcatccgggcgccagcaactggaactacgccgtcggcagcaaggccagcgccgaggcactgacctg
caacgcctacgcggatgcggccgagaagaagttcgacgcgcagctggccaaggaaacggccggggcccgctga

>>MEG_3531|Drugs|betalactams|Class_B_betalactamases|L1
atgcgttttatactgctcgccttcgccctggccgtcgctcttccggccgtccacgccagcgccgccgaggcaccgctgcc
acaactgcgggcctataccgtggatgcgtcctggctgcagccgatagcgccgctgcaggttgccgaccacacctggcaga
tcggcaccgaggacctgaccgcgctgctggtgcagaccgccgagggcgcagtactgctggatggcggcatgccacagatg
gccggtcacctgctggacaacgtgaagctgcgcggcgtggccccgcaggacctgcgattgatcctgctcagccatgcgca
tgccgaccacgccggcccggtcgccgagctcaagcgtcgcaccggcgcgcatgtggcggccaatgcagaaacggcggtgc
tgctggcgcgcggcggcagcaacgacctgcactttggcgacggcatcacctatccgccggccagcgccgaccgcatcatc
atggatggcgaagtggtcacggtgggcggcatcgcgttcaccgcgcacttcatgccagggcacaccccgggcagcaccgc
ctggacctggaccgacacccgcgatggcaagccggtgcgcatcgcctacgccgacagcctcagcgcaccgggttaccagc
tgaagggcaatccccgttatccgcgcctgatcgaggactacaagcgcagcttcgcaacggtgcgggcgctgccctgcgat
ctgctgctcaccccgcatccgggcgccagcaactggaactacgccgccggcagcaaggccagcaccgaggcactgacctg
caacgcctacgcggatgcggccgagaagaagttcgacgcgcagttggccagggaaacggccgggacccgctga

>>MEG_3532|Drugs|betalactams|Class_B_betalactamases|L1
atgctcgcccgtcgccgattcctgcagttcagtggtgctgccgttgcttcctcgctgcttgccccggcgttggcgcgagc
tgtttccccatcgtccggcatatccgccgcgaacgccgccattgccggcgccgccgatttcgccgcgctggagaaagcca
gtggtggccgtctgggcgtcaccgtgctgaacaccggtaacggccgtcgcatcggcggacatcgtcaggacgagcgcttc
ccgatgtgcagcacgttcaagtcgatgctggttgcccatgtgctgagccttgccgatgcaggccgcgtttcgctcgacac
acgtgtgcccatcgccgaaaaggatctgctgtcctacgccccggtggcgcgccgccatgtgggcaaggacctgacggtgc
gcgacctgtgccggggcacgctgaccaccagcgacaacacggcggccaacctgctgctggaggtggtgggcgggccgtcg
gcgctgactgcattcctgcgcgggcagggcgacagcgttacccgcaatgaccgcaacgagccggacgtgaatctgttcgc
gaagggagacccgcgcgataccaccagcccggccgcgatggccaccagcttggcccgcttcgcggtgggcaatggcctgc
agccggcatcgcgccagcagttcactgattggctcatcgacaaccagaccggcgatgcctgcctgcgcgccgggctggcc
aagcgctggcgggtgggggacaagaccggcagcaacggtgatgacacgcgcaacgacattgccgtgctgtggccgcatgc
gggcggcgcagcgtgggtggtcaccgcctatctgcagggcgcgtcggtcgatgacgatcagcgcgcagcggtgcttgcac
gggtgggggcgctggccgacgcgatgatcggatga

>>MEG_3533|Drugs|betalactams|Class_B_betalactamases|L1
ATGCGTTCTACCCTGCTCGCCTTCGCCCTCTCGTCGCTCGCCCTGGCCGCCACGCTCTTCACCTTCGACGGCGCCGCCGC
CGACGCATCGCTGCCACAGCTGCAGGCCTACACGGTGGACCCTTCCTGGCTGCAAACGATGGCGCCGTTGCAGATTGCCG
ATCACACCTGGCAGATCGGCACGCATGACCTGACGGCACTGCTGGTCCAGACGGCTGATGGCCTCGTCCTGATCGATGGT
GGCATGCCGCAAATGGCCTCTTACCTGCTGACCAACATGAAGGCCAGGGGAACCAATACCGGTCCCCTGCGCATGGTCCT
GCTCAGCCACGCGCACACCGATCACGCCGGCCCTGTGGCCGAGATCAAGCGCCGCACGGGGGCGCAGGTGGTCGTGAACG
CCGAAACCGCAGTGCTGCTGGCCCGAGGCGGCAGCGACGACCTTCATTTCGGCGACGAAATCACGTTTCCACCGGTCAAT
GCAGACCGCATCGTCATGGATCGGGAGGTCGTCAAGCTGGGCGGCATCGCGTTCACCGCCCATTTCATGCCCGGGCACAC
GCCGGGGAGCACCGCCTGGACCTGGACCGATACGCGCGATGGCAAGCCGGTGCGCATCGCCTATGCCGACAGCCTGAGCG
CGCCGGGCTACCAGCTGCAGGGCAATGCCCGCTATCCCCGCCTGGTTGAGGACTACCGACGCAGCTTCGCTACGGTGCGC
GGCCTGCCCTGCGACCTGTTGCTGACCCCGCATCCGGGCGCCAGCAACTGGAACTATGCTGCTGGCAGCAACGCCAGCGA
GAAGGTACTGAGCTGCAAAGCCTACGCGGATGCGGCCGAGAAGAAGTTCGACGCGCAGCTGGCCAAGGAAACGGCCGGGG
CCCGCTGA

>>MEG_3534|Drugs|betalactams|Class_B_betalactamases|L1
ATGCGCCTTTGCCTGACGACCCTTGCCCTGACTGCCACACTTGCCTTTGATGTGACTGCCGCCGACGCACCGCTGCCGCA
GCTGCAGGCCTACACCGTGGACGCCTCATGGCTGCAGCCGATGGCACCGCTGCAGATTGCCGACCACACCTGGCAGATCG
GCACCGAGGACCTGACCGCGCTGCTGGTGCAGACCGCCGACGGTGCGGTACTGCTCGACGGCGGCATGCCGCAGATGGCC
GGTCACCTGCTGGACAACATGAAGGCACGCGGGGTGGCAGCACAGGATCTACGGCTGATCCTGCTCAGCCATGCGCATGC
CGACCATGCCGGCCCGGTGGCGGAGCTGAAGCGCCGTACCGGCGCCAGCGTAGCGGCCAACGCCGAATCGGCGGTGCTGC
TGGCGCGCGGCGGCAGCAACGACCTGCACTTTGGCGACAGCATCACCTTTCCGCCGGCCAGCGCCGACCGCATCCTCATG
GATGGCGAAGGGGTCACCGTAGGCGGCATCGCGTTCACCGCGCACTTCATGCCGGGGCACACCCCAGGCAGCACCGCCTG
GACCTGGACCGATACCCGCGATGGCCAGCCGGTGCGCATCGCCTACGCCGACAGCCTGAGTGCGCCGGGCTACCAGCTGC
AGGGCAACGCCCGTTATCCACGCCTGGTCGAGGACTACCGGCGCAGCTTCGCTACGGTGCGCGCCCTGCCCTGCGACCTG
CTGCTGACGCCGCATCCGGGCGCCAGCAACTGGAACTATGCCGCGGGTGCAGAGGCCGGAGCCAACGCCCTGACCTGCAA
GGCCTACGCGGATGCGGCCGAGAAGAAGTTCGACGCACAGCTGGCCAGGGAAGCAGCCACGGCACGCTGA