MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

BLAB

The blaB gene encodes an Ambler class B beta-lactamase.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/10858348

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class B betalactamases

Sequences

Download Sequences

>>MEG_1250|Drugs|betalactams|Class_B_betalactamases|BLAB
atgaaaaaccaacgtcttacgcccctagcagctttcttacttttaatcagtgtggctgctacggctcacactctcccatc
acaaggtacagaaacaaaaggtgcagaaacaaatagtcccgccatcacctcactgacagggtgcggtccatcctcagcta
tcaaccaatttttcaaccaatttggaagcagcggtaaaatgcctgccgaacttggacgttggctgaatgatgcaaaggcc
caggccgtcgaaccctatcaggtatttgacaatgtttattatgtcggcatttgttgggtctcagcctggctcatcaaaac
cagcgaaggcccagtactaatagatacgctgtatggagaatttacagaccagcttatggataacattaaaaaaatcggcg
tcgagccatcagatatcaaaatggtactgctaacacacggacattttgatcatgtaggcggcgtatctaaactcaagtcg
ttaaccaacgcacgttttgtcatgtctgaggaaggatggaaggaagcgcaggctgatgcaaaaaaaacactggggaaacc
tagcgcatgggcaatgcctgacccagccaccacagatatcttggtgaaagacggcgatgcgttgacggtgggtgatacta
catttcatgcctacattaccccaggccacacttggggcaccacatcttatgtgcttgatgtcaaagagaggaataacacc
tatcacgcgattactattggcggattaggattaaatgctatagacggtccgcaacaggttgaggcctacatccgaagcat
agaccgtattaaggtgatggtggaagattctaagcaccccattacagtccatctcaccgcgcatccttttagtaacggtc
aaattgaaatgcaaaatcaactaaaagtacatcagcctgaccaaccacaccccatggtagatgcaaaagggctcctcaaa
cagttggcgacactccgcgcaggagcaatagaacgactggccgttgaacaggcacggattcaaaaatag

>>MEG_1251|Drugs|betalactams|Class_B_betalactamases|BLAB
atgttgaaaaaaataaaaataagcttgattcttgctcttgggcttaccagtttgcaggcatttggacaggagaatcctga
tgtcaaaattgaaaagctaaaagataatctgtatgtatacacaacctacaatacatttaacgggactaaatatgccgcaa
atgcagtatatctggtaactgataagggtgttgtggttatagactgtccgtggggagaagacaaatttaaaagctttacg
gacgagatttataaaaaacacggaaagaaagttattatgaatattgcaacacattctcatgatgatcgtgccggaggtct
tgaatattttggtaaaataggtgcaaaaacttattctactaaaatgacagattctattttagcaaaagagaataagccaa
gagcacaatatacttttgacaataataaatctttcaaagtaggaaaatccgagtttcaggtttactatcccggaaaaggg
cacacagcagataatgtggtggtatggtttccaaaagaaaaagtattggttggaggttgtattataaaaagtgctgattc
aaaggacctggggtatattggagaagcatatgtaaacgactggacgcagtctgtacacaatattcaacaaaagttttccg
gtgctcagtacgttgttgcagggcatgatgattggaaagatcaaagatcaatacaacatacactagacttaatcaatgaa
tatcaacaaaaacaaaaggcttcaaattaa

>>MEG_1252|Drugs|betalactams|Class_B_betalactamases|BLAB
atgttgaaaaggataaaaggattattggttctggccttaggttttacagggctacaggtttttgggcagcaaaatcctga
tattaaaattgaaaaattaaaagataatttatacgtctatacaacctataataccttcaaagggactaaatatgcagcta
atgcggtatatatggtaactgataaaggagtagtggtgatagactctccatggggagaagataaatttaaaagttttaca
gacgagatttataaaaagcatggaaagaaagtcatcatgaacattgctactcactctcatgatgatagagccggaggtct
tgagtattttggtaaattaggtgcaaaaacttattccactaaaatgacagattctatcttagcaaaagagaataagccaa
gagcaaagtacacttttgataataataaatcctttaaagtaggaaagactgaatttcaggtctattatccgggaaaaggt
catacagcagataatgtggtggtatggttccctaaagacaaagtattagtaggaggctgcattgtaaaaagcggtgattc
gaaagaccttgggtacattggagaagcttatgtaaatgactggacacagtccatacacaacattcagcagaaatttcccg
atgttcagtatgtcgttgcaggccacgatgactggaaagatcaaacatcaatacaacatacactggatttaatcagtgat
taccaacaaaaacaaaaggcttcaaattaa

>>MEG_1253|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTTTGCAGGCATTTGGACAGGAGAATCCTGA
TGTCAAAATTGAAAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCAA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATGAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGG
CACACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGTGCTGATTC
AAAGGACCTGGGGTATATTGGAGAAGCATATGTAAACGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCCG
GTGCTCAGTACGTTGTTGCAGGGCATGATGATTGGAAAGATCAAAGATCAATACAACATACACTAGACTTAATCAATGAA
TATCAGCAAAAACAAAAGGCTTCAAATTAA

>>MEG_1254|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGAAAGGATTAAAAGGGCTATTGGTTCTGGCTTTAGGCTTTACAGGACTACAGGTTTTTGGGCAACAGAACCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTCAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACCGATAAAGGAGTAGTGGTTATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGAAAGAAAGTTATCATGAACATTGCAACCCACTCTCATGATGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAAGACTGAGTTTCAGGTTTATTATCCGGGAAAAGGTCAT
ACAGCAGATAATGTGGTTGTGTGGTTTCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGTGGTGATTCGAA
AGACCTTGGGTTTATTGGGGAAGCTTATGTAAACGACTGGACACAGTCCATACACAACATTCAGCAGAAATTTCCCTATG
TTCAGTATGTCGTTGCAGGTCATGACGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1255|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTCTGCAGGCATTTGGACAGGAGAATCCTGA
TGTCAAAATTGAAAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCTA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATGAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGA
CACACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGCGCTGATTC
AAAAGACCTGGGGTATATTGGAGAAGCATATGTAAACGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCCG
GTGCTCAGTACGTTGTTGCAGGGCATGATGATTGGAAAGATCAAAGATCAATACAACGTACACTAGACTTAATCAATGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1256|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGATGAAGAAAATGAAATGGGCACTTGTTCTTGCTCTTGGACTTACAGGTTTAAATGCCTTCGGGCAGGAAACTCCTGA
AGTAAAAATAGAAAAGCTAAAAGACAATTTATATGTTTATACAACATATAATACATTCAACGGAACCAAATACGCAGCTA
ATGCGGTATATCTGGTGACCAGTAAAGGGGTGGTTGTAATAGATTCTCCATGGGGTGAGGAAAAATTTAAAAACTTTACC
GACGAAATTTATAAAAGACACGGAAAGAAAGTCATCATGAATATTGCAACCCATTCTCATGACGACCGTGCAGGAGGTTT
GGAATATTTTAAAAGCTTAGGGGTAAAAACCTATTCTACTAAAATGACAGACTCTATTTTAGCGAAAGATAATAAGCCAA
GAGCCCAGTATACTTTTGATAATAATAAATCATTTAAAGTAGGAAAGGATGAGTTTCAGGTCTATTATCCGGGAAAAGGA
CATACAGCTGACAATGTAGTGGTATGGTTCCCTAAAGATAAAGTACTGGTGGGAGGCTGTATTATAAAAAGCGGTGATTC
CAAAGATCTTGGATTTTTGGGAGAAGCATATGTAAACGACTGGACACAGTCAGTACACAATATTCAGAAGAAATTTCCCA
ATGTACAATATGTTGTTGCAGGCCACGATGACTGGAAAGATCAGACCGCCATTCAGCATACACTGGATTTAATCAGTGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1257|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGATGAAGAAAATGAAATGGGCACTTGTTCTTGCTCTTGGACTTACAGGTTTAAATGCCTTCGGGCAGGAAACTCCTGA
AGTAAAAATAGAAAAGCTAAAAGACAATTTATATGTTTATACAACATATAATACATTCAACGGAACCAAATACGCAGCTA
ATGCGGTATATCTGGTGACCAGTAAAGGGGTGGTTGTAATAGATTCTCCATGGGGTGAGGAAAAATTTAAAAACTTTACC
GACGAAATTTATAAAAGACACGGAAAGAAAGTCATCATGAATATTGCAACACATTCTCATGACGACCGTGCAGGAGGTTT
GGAATATTTTAAAAGCTTAGGGGTAAAAACCTATTCTACTAAAATGACAGACTCTATTTTAGCGAAAGATAATAAGCCAA
GAGCCCAGTATACTTTTGATAATAATAAATCATTTAAAGTAGGAAAGGATGAGTTTCAGGTCTATTATCCGGGAAAAGGA
CATACAGCTGACAATGTAGTGGTATGGTTCCCTAAAGATAAAGTACTGGTGGGAGGCTGTATTATAAAAAGCGGTGATTC
CAAAAATCTTGGATTTTTGGGAGAAGCATATGTAAACGACTGGACACAGTCAGTACACAATATTCAGAAGAAATTTCCCA
ATGTACAATATGTTGTTGCAGGCCACGATGACTGGAAAGATCAGACTGCCATTCAGCATACACTGGATTTAATCAGTGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1258|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGAAGAATATAATGCGGGCACTGATCCTTGTTTTTGGTTTTATGAGTTTTTTTATGTTTGGACAGGAGAATCCTGACGT
CAAAATTGAAAAGCTAAGAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCTAATG
CAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACGGAC
GAGATTTATAAAAAACACGGAAAGAAAGTTATTATGAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCTTGA
ATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGACAT
ACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGCGCTGATTCAAA
AGACCTGGGGTATATTGGAGAAGCATATGTAAATGACTGGACGCAGTCTGTACACAATATTCAACAGAAGTTTTCCGGTG
CTCAGTACGTTGTTGCGGGGCATGATGATTGGAAAGATCAAAGATCAATACAACGTACACTAGACTTAATCAATGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1259|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTCTGCAGGCATTTGGACAGGAGAATCCTGA
CGTTAAAATTGATAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCTA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATGAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGA
CATACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGCGCTGATTC
AAAAGACCTGGGGTATATTGGAGAAGCATATGTAAACGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCCG
GTGCTCAGTACGTTGTTGCAGGGCATGATGATTGGAAAGATCAAAGATCAATACAACGTACACTAGACTTAATCAATGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1260|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGATGAAGAAAATGAAATGGGCACTTGTTCTTGCTCTTGGACTTACAGGTTTAAATGCCTTCGGGCAGGAAACTCCTGA
AGTAAAAATAGAAAAGCTAAAAGACAATTTATATGTTTATACAACATATAATACATTCAACGGAACCAAATACGCAGCTA
ATGCGGTATATCTGGTGACCAGTAAAGGGGTGGTTGTAATAGATTCTCCATGGGGTGAGGAAAAATTTAAAAACTTTACC
GACGAAATTTATAAAAGACACGGAAAGAAAGTGATCATGAATATTGCAACACACTCTCATGATGACCGTGCAGGAGGTTT
GGAATATTTTAAAAGCTTAGGGGCAAAAACCTATTCTACTAAAATGACAGACTCTATTTTAGCGAAAGATAATAAGCCAA
GAGCCCAGTATACTTTTGATAATAATAAATCATTTAAAGTAGGAAAGGATGAGTTTCAGGTCTATTATCCGGGAAAAGGA
CATACAGCTGACCATGTAGTGGTATGGTTCCCTAAAGATAAAGTACTGGTGGGCGGCTGTATTATAAAAAGTGGGGATTC
CAAAGATCTTGGCTTTTTGGGAGAAGCATATGTAAACGACTGGACACAGTCAGTACACAATATTCAGAAGAAATTTCCCA
ATGTACAATATGTTGTTGCAGGCCACGATGACTGGAAAGATCAGACTGCCATTCAGCATACACTGGATTTAATCAGTGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1261|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAGATTAAAAGGATTATTGGTTCTGGCTTTAGGTTTTACAGGACTACAGGTTTTTGGACAGCAAAATCCTGA
TATTAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTTAAAGGAACTAAATATGCGGCTA
ATGCGGTATATATGGTAACGGATAAAGGAGTAGTGGTGATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACA
GACGAGATTTATAAAAAGCACGGAAAGAAAGTCATCATGAACATTGCTACCCATTCTCATGACGATAGAGCCGGAGGTCT
TGAATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAACACTGAGTTCCAGGTCTATTATCCGGGAAAAGGG
CATACGGCAGATAATGTGGTGGTATGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGTGGTGATTC
GAAAGACCTTGGATATATTGGAGAAGCTTATGTAAACGACTGGACACAGTCTATACACAATATTCAGCAGAAATTTCCCG
ATGTTCAGTATGTCGTTGCAGGCCACGATGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAT
TACCAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1262|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGAAAAGATTAAAAGGATTATTGGTTCTGGCTTTAGGTTTTACAGGACTACAGGTTTTTGGACAGCAAAATCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTTAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACGGATAAAGGAGTAGTGGTGATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGAAAGAAAGTCATCATGAACATTGCTACCCATTCTCATGACGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAACACTGAGTTCCAGGTCTATTATCCGGGAAAAGGTCAT
ACAGCAGATAATGTGGTTGTGTGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGCGGTGATTCGAA
AGACCTTGGGTTTATTGGAGAAGCTTATGTAAACGACTGGACACAGTCCATACACAACATTCAGCAGAAATTTCCCGATG
TTCAGTATGTCGTTGCAGGTCACGATGACTGGAAGGATCAAACATCAATACAGCATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1263|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGAAAGGATTAAAAGGGCTATTGGTTCTGGCTTTAGGTTTTACAGGACTACAGGTTTTTGGGCAACAGAACCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTCAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACCGATAAAGGAATAGTGGTTATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGTAAGAAAGTTATCATGAACATTGCGACCCACTCTCATGATGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAAGACTGAGTTTCAGGTCTATTATCCGGGAAAAGGTCAT
ACAGCAGATAATGTGGTTGTGTGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGTGGTGATTCGAA
AGACCTTGGGTTTATTGGAGAAGCTTATGTAAACGACTGGACACAGTCCATACACAATATTCAGCAGAAATTTCCCGATG
TTCAGTATGTCGTTGCAGGTCATGACGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1264|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGAAAGGATTAAAAGGACTATTGGTTCTGGCTTTAGGTTTTACAGGACTACAGGTTTTTGGGCAACAGAACCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACATATAATACCTTCAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACCGATAAAGGAGTAGTGGTTATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGAAAGAAAGTTATCATGAACATTGCGACCCACTCTCATGATGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAAGACTGAGTTTCAGGTCTATTATCCAGGAAAAGGTCAT
ACAGCAGATAATGTGGTTGTATGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGCGGTGATTCGAA
AGATCTTGGGTTTATTGGAGAAGCTTATGTAAACGACTGGACACAGTCCATACACAACATTCAGCAGAAATTTCCCGATG
TTCAGTATGTCGTTGCAGGTCATGACGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1265|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGAAAGGATTAAAAGGGCTATTGGTTCTGGCTTTAGGCTTTACAGGACTACAGGTTTTTGGGCAACAGAACCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTCAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACCGATAAAGGAGTAGTGGTGATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGAAAGAAAGTCATCATGAACATTGCTACACATTCTCATGACGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAACACTGAGTTCCAGGTCTATTATCCGGGAAAAGGTCAT
ACAGCAGATAATGTGGTGGTATGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGCGGTGATTCGAA
AGACCTTGGGTTTATTGGGGAAGCTTATGTAAACGACTGGACACAGTCCATACACAACATTCAGCAGAAATTTCCCGATG
TTCAGTATGTCGTTGCAGGTCATGACGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTA

>>MEG_1266|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTTTGAAGGCATTTGGACAGGAGAATCCTGA
TGTCAAAATTGAAAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCAA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATGAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGG
CACACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGTGCTGATTC
AAAGGACCTGGGGTATATTGGAGAAGCATATGTAAACGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCCG
GTGCTCAGTACGTTGTTGCAGGGCATGATGATTGGAAAGATCAAAGATCAATACAACATACACTAGACTTAATCAATGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1267|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGAAAGGATTAAAAGGGCTATTGGTTCTGGCTTTAGGCTTTACAGGACTACAGGTTTTTGGGCAACAGAACCCTGATAT
TAAAATTGAAAAATTAAAAGATAATTTATACGTCTATACAACCTATAATACCTTCAAAGGAACTAAATATGCGGCTAATG
CGGTATATATGGTAACCGATAAAGGAGTAGTGGTGATAGACTCTCCATGGGGAGAAGATAAATTTAAAAGTTTTACAGAC
GAGATTTATAAAAAGCACGGAAAGAAAGTCATCATGAACATTGCTACACATTCTCATGACGATAGAGCCGGAGGTCTTGA
ATATTTTGGTAAACTAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAAGAG
CAAAGTACACTTTTGATAATAATAAATCTTTTAAAGTAGGAAACACTGAGTTCCAGGTCTATTATCCGGGAAAAGGTCAT
ACAGCAGATAATGTGGTGGTATGGTTCCCTAAAGACAAAGTATTAGTAGGAGGCTGCATTGTAAAAAGCGGTGATTCGAA
AGACCTTGGGTTTATTGGGGAAGCTTATGTAAACGACTGGACACAGTCCATACACAACATTCAGCAGAAATTTCCCGATG
TTCAGTATGTCGTTGCAGGTCATGACGACTGGAAAGATCAAACATCAATACAACATACACTGGATTTAATCAGTGAATAT
CAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1268|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTTTGCAGGCATTTGGACAGGAGAATCCTGA
TGTCAAAATTGAAAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCAA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATTAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGG
CACACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGTGCTGATTC
AAAGGACCTGGGATATATTGGAGAAGCATATGTAAATGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCCG
GTGCTCAGTACGTTGTTGCAGGTCATGATGACTGGAAGGATCAAACATCAATACAGCATACATTGGATTTAATCAGTGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA

>>MEG_1269|Drugs|betalactams|Class_B_betalactamases|BLAB
ATGTTGAAAAAAATAAAAATAAGCTTGATTCTTGCTCTTGGGCTTACCAGTTTGCAGGCATTTGGACAGGAGAATCCTGA
TGTCAAAATTGAAAAGCTAAAAGATAATCTGTATGTATACACAACCTACAATACATTTAACGGGACTAAATATGCCGCAA
ATGCAGTATATCTGGTAACTGATAAGGGTGTTGTGGTTATAGACTGTCCGTGGGGAGAAGACAAATTTAAAAGCTTTACG
GACGAGATTTATAAAAAACACGGAAAGAAAGTTATTATTAATATTGCAACACATTCTCATGATGATCGTGCCGGAGGTCT
TGAATATTTTGGTAAAATAGGTGCAAAAACTTATTCTACTAAAATGACAGATTCTATTTTAGCAAAAGAGAATAAGCCAA
GAGCACAATATACTTTTGACAATAATAAATCTTTCAAAGTAGGAAAATCCGAGTTTCAGGTTTACTATCCCGGAAAAGGG
CACACAGCAGATAATGTGGTGGTATGGTTTCCAAAAGAAAAAGTATTGGTTGGAGGTTGTATTATAAAAAGTGCTGATTC
AAAGGACCTGGGATATATTGGAGAAGCATATGTAAATGACTGGACGCAGTCTGTACACAATATTCAACAAAAGTTTTCTG
GTGCTCAGTACGTTGTTGCAGGTCATGATGACTGGAAGGATCAAACATCAATACAGCATACATTGGATTTAATCAGTGAA
TATCAACAAAAACAAAAGGCTTCAAATTAA