MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

BCII

The BCII gene encodes an Ambler class B beta-lactamase.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/9761898

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class B betalactamases

Sequences

Download Sequences

>>MEG_1202|Drugs|betalactams|Class_B_betalactamases|BCII
atgaaaaagaatacattattaaaattaggggtatgtgttagtttgctaggaacaattcaatttgttagcacaatttcttc
tgtgaaagcggaacaaaagctagagcaaaaagtaataaagaatgagacaggaactatttcaatttctcagttaaacaaaa
atgtatgggttcatactgagctaggctattttaatggagtagcagttccttcgagtggtctagttcttactacttctaaa
gggttagtacttgtcgattcttcttgggatgataagttaacgaaggaactaatagagatggtagaaaagaaatttaagaa
gcgcgtaacggatgttattattacacatgcgcatgctgatcgaattggcggaataaaaacgttgaaagaaagaggcatta
aagcgcatagtacagcattaactgcggaactagcaaagaaaaatggatatgaagagccacttggagacttacaaacaatt
acgaatatgaagtttggaaatataaaagtagaaacgttctatccagggaaagggcatacagaagataatattgtcgtatg
gttaccgcaatacaacattttagctggaggctgtttagtgaaatctgcggaagctaaagatttagggaatgttgctgatg
catatgtaaatgaatggtccacatcgattgagaatgtgttgaagcgatatggaaatatgaacttagtagtgcctggtcat
ggagaagtaggggacagaggattatttttacatacattggatttgttgaaataa

>>MEG_1203|Drugs|betalactams|Class_B_betalactamases|BCII
atgaaaaagaatacgttgttaaaagtaggattatgtgtaagtttactaggaacaactcaatttgttagcacgatttcttc
tgtacaagcatcacaaaaggtagagcaaatagtaatcaaaaatgagacgggaaccatttcaatatctcagttaaacaaga
atgtatgggttcatacggagttaggttattttaatggagaagcagttccttcgaacggtctagttcttaatacttctaaa
gggctagtacttgttgattcttcttgggataacaaattaacgaaggaactaatagaaatggtagaaaagaaatttcagaa
gcgcgtaacagatgtcattattacacatgcgcacgctgatcgaattggcggaataacagcgttgaaagaaagaggcatta
aagcgcatagtacagcattaaccgcagaactagcaaagaaaagtggatatgaagagccacttggagatttacaaacagtt
acgaatttgaagtttggcaatacaaaagtagaaacgttctatccagggaaaggacatacagaagataatattgttgtttg
gttgccacaatatcaaattttagctggaggctgtttagtaaaatctgcggaagctaaaaatttaggaaatgttgcggatg
cgtacgtaaatgaatggtccacatcgattgagaatatgctgaagcgatatagaaatataaatttggtagtacctggtcac
gggaaagtaggagacaagggattacttttacatacattggatttattaaaataa

>>MEG_1204|Drugs|betalactams|Class_B_betalactamases|BCII
atgaaaaatacattattaaaattaggggtatgtgttagtttactaggaataactccatttgttagtacaatttcttctgt
acaagcagaacgaaaggtagagcataaagtaataaaaaatgagacaggaactatttcaatttctcagttaaacaaaaatg
tttgggttcatacggagttaggttattttaacggagaagcagttccttcgaacggtttaatccttaatacttctaaagga
ttagtacttgtcgattcttcttgggatgataagttaacgaaggaattaatagagatggcagaaaagaaatttaagaagag
tgtaacggatgttattattacacatgcacacgctgatcggattggtggaataaaaacgttgaaagaaagaggcattaaag
cgcatagtacaacgttaactgcggaactagcaaagaaaaatggatatgaagaaccacttggagacttacaagcaattacg
aaattgaagtttggaaatatgaaagtagaaacgttttatccagggaaaggacatacagaagataatatcgtcgtatggtt
accacaatacaacatgttagttggaggctgtttagtgaagtctgcgtccgcgaaagatttaggaaatattactgatgctt
atgtaaatgaatggtctacatcgattgagaatgtgctgaagcgatatgaaaatataaattttgtagtacctggtcatgga
gaagtaggggacaaaggattacttttacatacattggatttgttaaaataa

>>MEG_1205|Drugs|betalactams|Class_B_betalactamases|BCII
atgaaaaatacattattaaaattaggggtatgtgttagtttactaggaataactccatttgttagtacaatttcttctgt
acaagcagaacgaacggtagagcataaagtaataaaaaatgagacaggaactatttcaatttctcagttaaacaaaaatg
tttgggttcatacggagttaggttattttaacggagaagcagttccttcgaacggtttaatccttaatacttctaaagga
ttagtacttgtcgattcttcttgggatgataagttaacgaaggaattaatagacatggcagaaaagaaatttaagaaccg
cgtaacggatgttattattacacatgcacacgctgatcggattggtggaataaaaacgttgaaagaaagaggcattaaaa
cgcatagtacaacgttaactgcggaactagcaaagaaaaatggatatgaagaaccacttggagacttacaagcaattacg
aaattgaagtttggaaatatgaaagtagaaacgttttatccagggaaaggacatacagaagataatatcgtcgtatggtt
accacaatacaacatgttagttggaggctgtttagtgaagtctgcgtccgcgaaagatttaggaaatattactgatgctt
atgtaaatgaatggtctacatcgattgagaatgtgctgaagcgatatgaaaatataaattttgtagtacctggtcatgga
gaagtaggggacaaaggattacttttacatacattggatttgttaaaataa

>>MEG_1206|Drugs|betalactams|Class_B_betalactamases|BCII
ATGAAAAATACATTATTAAAATTAGGGGTATGTGTTAGTTTACTAGGAATAACTCCATTTGTTAGTACAATTTCTTCTGT
ACAAGCAGAACGAACGGTAGAGCATAAAGTAATAAAAAATGAGACAGGAACTATTTCGATTTCTCAGTTAAACAAAAATG
TATGGGTTCATACGGAGTTAGGTTATTTTAGCGGAGAAGCAGTTCCTTCGAACGGTTTAGTCCTTAATACTTCTAAAGGG
TTAGTACTTGTCGATTCTTCTTGGGATGATAAGTTAACGAAGGAATTAATAGAGATGGTAGAAAAGAAATTTAAGAAGCG
CGTAACAGATGTCATTATTACACATGCACACGCTGATCGAATTGGTGGAATGAAAACATTGAAAGAAAGGGGCATTAAAG
CGCATAGTACAGCGTTAACTGCGGAATTAGCAAAGAAAAATGGATATGAAGAACCACTTGGAGACTTACAAAGCGTTACA
AATTTGAAGTTTGGAAATATGAAAGTAGAAACATTTTATCCAGGGAAGGGACATACAGAAGATAATATTGTTGTTTGGTT
GCCACAATATCAAATTTTAGCTGGAGGCTGTTTAGTTAAATCTGCGTCCTCTAAAGATTTAGGAAACGTTGCTGATGCGT
ATGTAAATGAATGGTCCACATCGATTGAAAATGTGCTGAAGCGATATGGAAATATAAATTTAGTAGTGCCTGGTCATGGA
GAAGTAGGGGATAGAGGATTACTTTTACATACATTGGATTTGTTGAAATAA