MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

PENA

The penA gene encodes an Ambler class A beta-lactamase.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC164135/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class A betalactamases

Sequences

Download Sequences

>>MEG_5751|Drugs|betalactams|Class_A_betalactamases|PENA
atgacctactcatcgaaacgtcgaaccctgttgctggccgccgcgacggcgccgctcgttctcaccgtcaccgcgtgcgc
gtcacggcaggctgccgcgccggacgaggcaagcgccgcggccgcggccgcggcggcggccgtggcgcctgccgccgccg
ggcagatgctagccgagctcgaaagcagcgtgggcggccgcctcggcgtgtgcgcaatcgacacggcgagcggccggatc
atcgagcatcgcgcggacgaacgcttcccgttctgcagcacgttcaaggcgatgctgagtgcggcggtgcttgcgcagag
cgtcgggcggccggcgttgctgcaacagcgcgtgacgtatacccgggccgatctcgtcaactattcgccggtgtcggaga
agcatgtcggcgagggcatgacggtcgccgcgttgtgcgaggccgcgatccagtacagcgacaactcggccgcgaacctg
ctgatgaagctgctcggcggcccgtcggcggtgacggcctacgcgcgctcgatcggcgacgacacgttcaggctcgatcg
atgggagaccgaactgaataccgcgctgccgggcgacctgcgcgacacgacgacaccggccgcgatggccgcgagcatgc
gcgtgctgatggtcggcgatgcgctgccggccgcgcagcgtgcgcagctcgttgcgtggatgcgtggcaacaaggtgggc
gacaagcggctccgcgcgggcgtgccggccgggtggacggtcggtgacaagacgggcaccggcgactacgggacgaccaa
cgacgcgggtgtcgtatggtcgccgtcgcgtgtgccgatcgcggtggccgtgtactacacgcagacgcgtgccgatgcgc
gctcgaaggacgacgtgatcgcgtcggtcgcgcgcatcgtggttcaggccttcggttga

>>MEG_5752|Drugs|betalactams|Class_A_betalactamases|PENA
ATGAATCCTCCAATCCATCGCCGCACCCTGTTGCTCGCCGCCTCGGTCCTCCCGCTCGCAAGCGCCTGCACCGCGTGGTC
CGCCAAGGGGCCGCAGCAAGACGCATCGGCGCAGCTCGCCGCGCTCGAAGCCGCATCGGGCAGCCGGCTCGGTGTGGTCG
GTTTCAACACCGCCACCGGCGCGCGCGTGCAGCACCGTGCCGAGGAACGCTTTCCGTTCTGCAGCACCTTCAAGCTCATG
CTGGCCGCGGCCGTCCTCGAACGCAGCGCGAAAGAGGGCGACCTGCTCGCGCGCCGCGTCAACTACAGCAAGGGCGACCT
GGTCTCCTACTCGCCCATCACCGAAAAGAATGTGGCGACCGGCATGACGGTGGCCGAGCTGTGCGCCGCCACCGTCCAGT
ACAGCGACAACGGCGCGGCCAACCTGCTGATGAAGATCCTGGGCGGCCCGTCCGCCGTGACGGCCTTTGCGCGTGCCTCC
GGCGACGAGGTCTTCAGGCTGGACCGCTGGGAGACCGAACTCAACACCGCCATCCCCGGCGACCTGCGCGACACCACCAC
GCCCGCGGCCATGGCGGCAAGCGTGCAGCGGCTGGTGCTGGGCAACGCGCTGGGCGCGGCACAGCGCGAGCAGCTCAAGA
CCTGGTTGCTGGGCAACACCACGAGCACCCAGCGCTTCCTGGCCGGCGTGCCCGCCGGCTGGAAGGTGGGCGACAAGACC
GGTTCGGGCTCCTACGGCACCACGAACGACGTGGGCGTGCTGTGGCCGCCGGCCGGCGCGCCGCTGGTGCTGGCGGTCTA
CCTGACGTTTCCGCAGAAGGAGGCGAAGGGGCGCAGCGATGTGGTTGCGTCGGCGACGCGCATTGCGGTGAGCGCGCTGG
CGAGCTGA