MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

BLAZ

the blaZ gene encodes a beta-lactamase.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3361877/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class A betalactamases

Sequences

Download Sequences

>>MEG_1320|Drugs|betalactams|Class_A_betalactamases|BLAZ
ttgaaaaagttaatatttttaattgcaattgctttagttttaagtgcatgtaattcaaacagttcacatgccaaagagtt
aaatgatttagaaaaaaaatataatgctcatattggtgtttatgctttaaatactaaaagtggtaaggaagtaaaattta
attcagataagagatttgcctatgcttcgacttcaaaagcgataaatagtgctattttgttagaacaagtaccttataat
aagttaaataaaaaagtacatattaacaaagatgatatagttgcttattctcctattttagaaaaatatgtaggaaaaga
tatcactttaaaagaacttattgaggcttcaatgacatatagtgataatacagcaaacaataaaattataaaagaaatcg
gtggaatcaaaaaagttaaacaacgtctaaaagaactaggagataaagtaacaaatccagttagatatgagatagaatta
aattactattcaccaaagagcaaaaaagatacttcaacgcctgctgctttcggcaagactttaaataaacttatcgcaaa
tggaaaattaagcaaaaaaaataaaaatttcttacttgatttaatgtttaataataaaaacggagacactttaattaaag
atggtgttccaaaagactataaggttgctgataaaagtggtcaagcaataacatatgcttctagaaatgatgttgctttt
gtttatcctaagggccaatctgaacctattgttttagtcatttttacgaataaagacaataaaagtgataagccaaatga
taagttgataagtgaaaccgccaagagtgtaatgaaggaattttaa

>>MEG_1321|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1322|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAATTAATAATTTTAATCATGTTAGCATTGATATTAAGTGCTTGTAATACTAAGCATTCAACTAATAATGATAT
TGAAAAACTCGAAAAAAAATATGGTGCTAACATAGGTATGTATGCGCTTAACACTCAAAACAGTGAAGCATTATCATTTA
ATGAAAATAAACGTTTTGCTTATGCTTCCACATTAAAAGCTATAAGTAGTGCCATGCTACTTGAGCAAACACCTTACAAC
AAATTAGATAAAAAAATTCACATCAACAAAGATGATATCGTTCCATATTCACCAGTGTTAGAGAAATATATCGGCAAAGA
GATAACTATTAAAAAACTTATAGAAGCTACCATGTTATTTAGCGATAACACTGCTAACAATAAAATTATCGATGAATTAG
GAGGGTATGAGCATGTAAAAAATAGACTGACAGATTTAGGAGATACAACTACACATCCATCTAGAAAAGAACCCGACTTA
AATTTTTATTCGCCAAAGGATAAACGAGATACAACTACTCCAATGGCCTATGGTAAATCTTTAAATAAACTTATAGTTGA
TGGAAATCTTAGTAAAGCGAACAAAGATTTATTGCTTGACTTAATGTTGAAAAATAAAAGTGGCGATACATTAATTAAGG
ATGGCGCACCTTCAAACTTTAAAGTTATGGATAAGAGTGGTCAGGCACTAACATACGGTTCAAGAAACGATGTTGCACTT
GTTTATCCAGATGGACAAGATAAACCTATCATTTTAGTTATATTTACAAATAAAGATAAAAAGGATGGTAAACCTAATGA
TAAAATAGTAAGTGAAGTCGCCGAAATTGTATTAAAAAATATGAGTAAATAA

>>MEG_1323|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAATTAATAATTTTAGTCGTGTTAGCGTTGATATTAAGTGCTTGTAATAGTAAGAATTCAACTAATAACGACAT
TGAAAAGATCGAAAAAAAATATGGTGCTAACGTAGGTATGTATGCTCTTAATACTCAAAATGGTAAAGAATTATCATTTA
ATGAAAATAAGCGTTTTGCATATGCTTCCACATTAAAAACTATAAGTAGCGCAATGCTGCTTGAACAAACACCTTACAAC
AAATTAGATAAAAAAATTCACATTAATAAAGATGATATTGTTCCATATTCACCAGTGTTAGAAAAATATATTGGCAAAGA
GATAACTTTAAAAAAGCTTATAGAAGCTACCATGTTATTTAGCGATAACACGGCTAATAATAAAATTATCGATGAATTGG
GAGGATATGGGCAAGTAAAAACGAAACTGATAGATTTAGGCGATACAACGACACATCCATCTAGAAAAGAACCAGACTTA
AATTTTTATTCACCAAAGGATAAACGAGATACAAGTACTCCATTAGCCTATGGTAAAACTTTAAAGAAACTTATAGCTGA
TGGAGATCTTAGCAAAGCAAACAAAGATTTCTTACTTAATCTAATGTTCAAAAATAAAAGTGGCGATACATTAATTAAGG
ATGGTGCACCTTCAAACTTTAAAGTTATGGATAAGAGCGGTCAAGCACTAACATACGGTTCAAGAAACGATGTTGCGTTT
GTTTATCCAGATGGACAAGATAAACCTATAATTCTGGTGATATTTACAAATAAAGATAGAAAAGATGGTAAACCTAATGA
CAAAATAGTAAGTGAGGTTGCTGAAATTGTACTAAAAAATATTAATGAGTAA

>>MEG_1324|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCCTTCGGTAAGACCCTTAATAAACTTATCGCCAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1325|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAARCAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTARCAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGGCATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATTG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGAYAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1326|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1327|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1328|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTAAAATTCCTTCATTACACTCTTGGCGGTTTCACTTATCAACTTATCATTTGGCTTATCACTTTTATTGTCTTTATTCG
TAAAAATGACTAAAACAATAGGTTCAGATTGGCCCTTAGGATAAACAAAAGCAACATCATTTCTAGAAGCATATGTTATT
GCTTGACCACTTTTATCAGCAACCTTATAGTCTTTTGGAACACCATCTTTAATTAAAGTGTCTCCGTTTTTATTATTAAA
CATTAAATCAAGTAAGAAATTTTTATTTTTTTTGCTTAATTTTCCATTTGCGATAAGTTTATTTAAAGTCTTGCCGAAAG
CAGCAGGCGTTGAAGTATCTTTTTTGCTCTTTGGTGAATAGTAATTTAATTCTATCTCATATCTAACTGGATTTGTTACT
TTATCTCCTAGTTCTTTTAGACGTTGTTTAACTTTTTTGATTCCACCGATTTCTTTTATAATTTTATTGTTTGCTGTATT
ATCACTATATGTCATTGAAGCCTCAATAAGTTCTTTTAAAGTGATATCTTTTCCTACATATTTTTCTAAAATAGGAGAAT
AAGCAACTATATCATCTTTGTTAATATGTACTTTTTTATTTAACTTATTATAAGGTACTTGTTCTAACAAAATAGCACTA
TTTATCGCTTTTGAAGTCGAAGCATAGGCAAATCTCTTATCTGAATTAAATTTTACTTCCTTACCACTTTTAGTATCTAA
AGCATAAACACCAATATGAGCATTATATTTTTTTTCTAAATCATTTAACTCTTTGGCATGTGAACTGTTTGAATTACATG
CACTTAAAACTAAAGCAATTACAATTAAAAATATTAACTTTTTCAA

>>MEG_1329|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCGCTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTATTCCAAAAGACTATAAAGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1330|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTAAAATTCCTTCATTACACTCTTGGCGGTTTCACTTATCAACTTATCATTTGGCTTATCACTTTTATTGTCTTTATTCG
TAAAAATGACTAAAACAATAGGTTCAGATTGGCCCTTAGGATAAACAAAAGCAACATCATTTCTAGAAGCATATGTTATT
GCTTGACCACTTTTATCAGCAACCTTACAGTCTTTTGAAACACCGTCTTTAATTAAAGTATCTCCGCTTTTATTATTTAA
CATTAAATCAAGTAAGAATTTTTTGTTTTCTTTGCTTAATTTTCCATTTGCGATAAGTTTATTTAAAGTCTTACCGAAAG
CAGCAGGTGTTGAAGTATCTTTTTTGCTCTTTGGTGAATAGTAATTTAATTCTATCTCATATCTAACTGGATTTGTTACT
TTATCTCCTAGTTCTTTTAGACGTTGTTTAACTTTTTTGATTCCACCAATTTCTTTTATAATTTTATTGTTTGCTGTATT
ATCACTATATGCCATTGAAGCCTCAATAAGTTCTTTTAAAGTGATATCTTTTCCTACATATTTTTCTAAAATAGGAGAAT
AAGCAACTATATCATCTTTGTTAATATGTATTTTTTTATTTAACTTATTATAAGGTACTTGTTCTAACAAAATAGCACTA
TTTATCGCTTTTGAAGTCGAAGCATAGGCAAATCTCTTATCTGAATTAAATTTTACTTCCTTACCACTTTTAGTATCTAA
AGCATAAACACCAATATGAGCATTATATTTTTTTTCTAAATCATTTAACTCTTTGGCATGTGAACTGTTTGAATTACATG
CACTTAAAACTAAAGCAATTGCAATTAAAAATATTAACTTTTTCAA

>>MEG_1331|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTACATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1332|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1333|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTACACATACTAAAGAGTT
AAATAATTTAGAAAAAAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAAGTTGCTGATAAAAGTGGTCAAGCAATAACATTTGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1334|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATACTAAAGAGTT
AAATAATTTAGAAAAAAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAAATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1335|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAAAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAAAGATTTGCCTATGCTTCAACTTCAAAAGCAATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTCAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAAGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1336|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGCACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1337|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1338|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTGATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTACTGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1339|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAATCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1340|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTTTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1341|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGATGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1342|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTTAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTGATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1343|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAAAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCGAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ATGGTGTTTCAAAAGACTGTAAGGTGGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1344|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAAAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACACATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ATGGTGTTTCAAAAGACTGTAAGGTGGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1345|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1346|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGAACAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1347|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATGATACAGCAAACAATAAAATTATAAAAGAGATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTATTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1348|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATTG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1349|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1350|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGGCATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATTG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1351|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAGATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTATTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1352|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAGATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTATTATTCACCAAAGAACAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1353|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGGCATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1354|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1355|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGGCATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATTG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1356|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAATAGTTCACATGCCAAAGAGTT
AAATGATTTAGAGAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAGAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1357|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTTCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAAAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ATGGTGTTTCAAAAGACTGTAAGGTGGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1358|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAATTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1359|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1360|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1361|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAGATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTATTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1362|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAGATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTATTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1363|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGAAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1364|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1365|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCAAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1366|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCATTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1367|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAATGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1368|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTTCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1369|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCACAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1370|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCGAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1371|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATGGCTTTAGTTTTAAGTGCATGTAATTCAAACGGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
CATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCGCCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1372|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAAAAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1373|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAAAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ATGGTGTTTCAAAAGACTGTAAGGTGGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1374|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCAAATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1375|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCAAATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTATTCCAAAAGACTATAAAGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1376|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATACCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTACGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1377|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATACCCAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACATCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1378|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAGATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTATTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1379|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATACAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1380|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATACAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1381|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGATGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1382|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGCTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1383|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1384|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAGATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTATTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1385|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1386|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGAAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1387|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCACAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1388|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAAATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1389|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAACCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1390|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1391|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATAACGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1392|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAAGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1393|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAAGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1394|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAAAACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1395|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1396|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCGATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1397|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAGCAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1398|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1399|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1400|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGCATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1401|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTTAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1402|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAGATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTATTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1403|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGGCATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATTG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTATTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1404|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAACAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTATTCCAAAAGACTATAAAGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1405|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCCAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGGTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACATCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGACAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAACCGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1406|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1407|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGATTCATAGAAATTACAACTGTAATATTGGAGGGTATATTTTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGT
TTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTTAAATAATTTAGAAAAAAAATATAATGCTAATATTGGTG
TCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTAATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAA
GCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAATAAGTTAAATAAAAAAGTACATATTAACAAAGATGATAT
AGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGATATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGT
ATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCGGTGGAATCACAAAAATTAAAAAACGTTTAAAAAAATTG
GGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTAAATTACTATTCACCAAAGAGCAAAAAAGATACTTCAAC
GCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAATGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTG
ATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAGATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGT
GGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTTATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGT
CATTTTTACGAATAAAGACAACAAAAGTGATAAACCTAATGATAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACA
AATTTTAA

>>MEG_1408|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGATTTATAAAAATTACAACTGTAATATCGGAGGGTTTATTTTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGT
TTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTTAAATGATTTAGAAAAAAAATATAATGCTCATATTGGTG
TTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTAATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAA
GCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAATAAGTTAAATAAAAAAGTACATATTAACAAAGATGATAT
AGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGATATCACTTTAAAAGCACTTATTGAGGCTTCAATGACAT
ATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCGGTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTA
GGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTAAATTACTATTCACCAAAGAGCAAAAAAGATACTTCAAC
ACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAATGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTG
ATTTAATGTTAAATAATAAAACCGGAGATACTTTAATTAAAGACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGT
GGTCAAGCAGCAACATATGCTTCTAGAAATGATGTTGCTTTTGTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGT
CATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGATAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGG
AATTTTAA

>>MEG_1409|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGATTTATAAAAATTACAACTGTAATATCGGAGGGTTTATTTTGAAAAGGTTAATATTTTTAATTGTAATTGCTTTAGT
TTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTTAAATGATTTAGAAAAAAAATATAATGCTCATATTGGTG
TTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTAATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAA
GCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAATAAGTTAAATAAAAAAGTACATATTAACAAAGATGATAT
AGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGATATCACTTTAAAAGAACTTATTGAGGCTTCAATGACAT
ATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCGGTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTA
GGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTAAATTACTATTCACCAAAGAGCAAAAAAGATACTTCAAC
GCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAATGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTG
ATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAGATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGT
GGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTTGTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGT
CATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGATAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGG
AATTTTAA

>>MEG_1410|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGATTTATAAAAATTACAACTGTAATATCGGAGGGTTTATTTTGAAAAGGTTAATATTTTTAATTGTAATTGCTTTAGT
TTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTTAAATGATTTAGAAAAAAAATATAATGCTCATATTGGTG
TTTATGCTTTAAATACTAAAAGTGGTAAGGAAGTAAAATTTAATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAA
GCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAATAAGTTAAATAAAAAAGTACATATTAACAAAGATGATAT
AGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGATATCACTTTAAAAGAACTTATTGAGGCTTCAATGACAT
ATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCGGTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTA
GGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTAAATTACTATTCACCAAAGAGCAAAAAAGATACTTCAAC
GCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAATGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTG
ATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAGATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGT
GGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTTGTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGT
CATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGATAAGTTGATAAGTGAAACCTCCAAGAGTGTAATGAAGG
AATTTTAA

>>MEG_1411|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGATTTATAGAAATTACAACTGTAATATTGGAGGGTATATTTTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGT
TTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTTAAATAATTTAGAAAAGAAATATAATGCTAATATTGGTG
TCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTAATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAA
GCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAATAAGTTAAATAAAAAAGTACATATTAACAAAGATGATAT
AGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGATATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGT
ATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCGGTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTG
GGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTAAATTACTATTCACCAAAGAGCAAAAAAGATACTTCAAC
GCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAATGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTG
ATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAGATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGT
GGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTTATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGT
CATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGATAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACA
AATTTTAA

>>MEG_1412|Drugs|betalactams|Class_A_betalactamases|BLAZ
ATGTTCGTTTTAAACAAGTTCTTTACCAATTCACATTATAAAAAGATTGTACCTGTCGTATTACTTTCATGCGCGACACT
GATAGGCTGTTCTAATAGTAATACGCAATCAGAATCAAATAAACAAACAAATCAAACCAATCAAGTTAAGCAAGAAAATA
AACGTAATCATGCTTTTGCTAAACTTGAAAAAGAATATAACGCTAAACTTGGTATTTACGCACTGGACACAAGTACGAAT
CAGACTGTTGCTTACCATGCAGATGATCGTTTTGCATTTGCCTCTACATCTAAATCATTAGCAGTGGGAGCTCTTTTACG
TCAGAATTCAATAGAAGCTCTTGATGAAAGAATTACGTATACACGTAAAGACCTATCTAATTATAATCCAATTACTGAAA
AGCATGTGGATACAGGAATGACGTTAAAAGAACTTGCAGATGCTTCTGTTCGATATAGTGACAGTACGGCACATAATTTA
ATTCTTAAAAAGTTAGGTGGTCCATCCGCATTTGAAAAAATCTTGAGGGAAATGGGTGATACTGTTACTAACTCCGAGCG
ATTTGAACCTGAATTAAATGAAGTAAATCCAGGAGAAACACATGATACGAGTACACCAAAAGCAATCGCTAAGACGCTTC
AATCTTTTACATTAGGAACTGTACTACCATCTGAGAAACGTGAACTGTTAGTAGATTGGATGAAGAGAAATACGACTGGG
GATAAATTAATTCGTGCGGGTGTACCAAAAGGATGGGAAGTAGCTGATAAAACAGGTGCAGGATCTTATGGAACAAGGAA
TGATATCGCAATTATTTGGCCACCAAATAAAAAGCCGATTGTTCTTTCCATCCTTTCTAATCATGATAAAGAAGATGCAG
AATACGATGATACACTTATTGCAGACGCTACGAAAATCGTGTTAGAAACTCTAAAGGTTACGAATAAATAA

>>MEG_1413|Drugs|betalactams|Class_A_betalactamases|BLAZ
ATTGTAATATTATTTATTTATAAAAATTACAATTGTAATATTGGAGGGTTTATTTTGAAAAAGTTAATATTTTTAATTGC
AATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAAAGTTAAATGATTTAGAAAAAAAATATAATG
CTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTAATTCAGATAAGAGATTTGCCTATGCT
TCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAATAAGTTAAATAAAAAAATACATATTAA
CAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGATATCACTTTAAAAGAACTTATTGAGG
CTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCGGTGGGATCAAAAAAGTTAAACAACGT
CTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTAAATTACTATTCACCAAAGAGCAAAAA
AGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAATGGAAAATTAAGCAAAGAAAACAAAA
AATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAGATGGTGTTTCAAAAGACTGTAAGGTG
GCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTTGTTTATCCTAAGGGCCAATCTGAACC
TATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGATAAGTTGATAAGTGAAACCGCCAAGA
GTGTAATGAAGGAATTTTAA

>>MEG_1414|Drugs|betalactams|Class_A_betalactamases|BLAZ
ATTTTGAAAAAGTTAATATTTTTAATTGTAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGA
GTTAAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAAT
TTAATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTAT
AATAAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAA
AGATATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAA
TCGGTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAA
TTAAATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGC
AAATGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTA
AAGACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCT
TTTGTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAA
TGATAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1415|Drugs|betalactams|Class_A_betalactamases|BLAZ
ATTTTTAAACCGCTATTGACACATGCTAAAGAGTTAAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGC
ATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTAATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAA
ATAGTGCTATTTTGTTAGAACAAGTACCTTATAATAAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCT
TATTCTCCTATTTTAGAAAAATATGTAGGAAAAGATATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGA
TAATACAGCAAACAATAAAATTATAAACGAAATCGGTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATA
AAGTAACAAATCCAGTTAGATATGAAATAGAATTAAATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCT
GCTTTCGGCAAGACTTTAAATAAACTTATCGCAAATGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAAT
GTTAAATAATAAAAACGGAGACACTTTAATTAAAGATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAG
CAATAACATATGCTTCTAGAAATGATGTAGCTTTTATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTT
ACGAATAAAGACAATAAAAGTGATAAACCTAATGATAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTA
A

>>MEG_1416|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTACTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATACTAAAGAGTT
AAATAATTTAGAAAAAAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAAGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1417|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATATAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1418|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATATAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1419|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1420|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1421|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTTCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGGCATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATTG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1422|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATACTAAAGAGTT
AAATAATTTAGAAAAAAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAAATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTTAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGA

>>MEG_1423|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATACTAAAGAGTT
AAATAATTTAGAAAAAAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAAGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1424|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAAAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCGCTTTAAAAGAACTTATTGAGGCTTCAATGAAGTACAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAATTTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAAGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1425|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAATGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1426|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1427|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1428|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGAACAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1429|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATATAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1430|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACATTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1431|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATACTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1432|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAGCCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1433|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAATAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1434|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATCGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATATAATAAACAAATTTTAA

>>MEG_1435|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCCCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1436|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAATGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1437|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATATAATAAACAAATTTTAA

>>MEG_1438|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACGCTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1439|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGCACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1440|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCGCTTTAAAAGAACTTATTGAAGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1441|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTATCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAACAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1442|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AAATAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGGCATATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
GTTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1443|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATGCTAAAGAGTT
AATTAATTTAGAAAAGAAATATAATGCTAATATTGGTGTCTATGCATTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATGCCGATAAGAGATTTGCCTATGCTTCAACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAACGAAATCG
GTGGAATCAAAAAAATTAAAAAACGTTTAAAAAAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAAATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1444|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATACTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAACCAGTTCACATTCTAAAGAGTT
AAATAATTTAGAAAAAAAATATAATGCTAATATTGGTGTCTATGCTTTAGACACTAAAAGTGGTAAGGAAGTAAAATATA
ATGCTGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAGTACATATTAACAAAGATGATATAGTTGCTTATTCTCCCATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGAAGTATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATAG
GTGGAATCAAAACAATTAAAAAACGCTTAAAAGAATTGGGAGATAAAGTAACAAATCCAGTTAGATATGAGATTGAATTG
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACGCCTGCTGCTTTCGGCAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAAAAAATAAAAATTTCTTACTTGATTTAATGTTAAATAATAAAAACGGAGACACTTTAATTAAAG
ATGGTGTTCCAAAAGACTATAAAGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTAGCTTTT
ATTTATCCTAAGAACCAATCTGAACCTATTATTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAACCTAATGA
TAAATTGATAAGTGAAACCGCCAAGAATGTAATAAACAAATTTTAA

>>MEG_1445|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTACACATGCCAAAAAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ATGGTGTTTCAAAAGACTGTAAGGTGGCTGATAAAAGTGGCCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1446|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAAAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGAAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ATGGTGTTTCAAAAGACTGTAAGGTGGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1447|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAAAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ATGGTGTTTCAAAAGACTGTAAGGTGGCTGATAAAAGTGGTCAAGCAATAAAATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1448|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAAAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ATGGTGTTTCAAAAGACTGTAAGGTGGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
ATTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1449|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAAAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACACATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ATGGTGTTTCAAAAGACTGTAAGGTGGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
ATTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1450|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAAAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAATACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTCAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACACATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ATGGTGTTTCAAAAGACTGTAAGGTGGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1451|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGAACAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTCCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1452|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGAACAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1453|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1454|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1455|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAGATCG
GTGGGATCAAAAAAGTTAAACAACGTCTAAAAGGACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTCCAAAAGACTATAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA

>>MEG_1456|Drugs|betalactams|Class_A_betalactamases|BLAZ
TTGAAAAAGTTAATATTTTTAATTGCAATTGCTTTAGTTTTAAGTGCATGTAATTCAAACAGTCCACATGCCAAAGAGTT
AAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGATACTAAAAGTGGTAAGGAAGTAAAATTTA
ATTCAGATAAGAGATTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCTTATAAT
AAGTTAAATAAAAAAATACATATTAACAAAGATGATATAGTTGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGA
TATCACTTTAAAAGAACTTATTGAGGCTTCAATGGCATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATTG
GTGGAATCAAAAAAGTTAAACAACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATAGAATTA
AATTACTATTCACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCTTTCGGTAAGACTTTAAATAAACTTATCGCAAA
TGGAAAATTAAGCAAAGAAAACAAAAAATTCTTACTTGATTTAATGTTAAATAATAAAAGCGGAGATACTTTAATTAAAG
ACGGTGTTTCAAAAGACTGTAAGGTTGCTGATAAAAGTGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTT
GTTTATCCTAAGGGCCAATCTGAACCTATTGTTTTAGTCATTTTTACGAATAAAGACAATAAAAGTGATAAGCCAAATGA
TAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAATTTTAA